Incidental Mutation 'H8786:Kcnab3'
ID44458
Institutional Source Beutler Lab
Gene Symbol Kcnab3
Ensembl Gene ENSMUSG00000018470
Gene Namepotassium voltage-gated channel, shaker-related subfamily, beta member 3
SynonymsmKv(beta)4, C330022D06Rik, Kcnab4
Accession Numbers

Ncbi RefSeq: NM_010599.4; MGI:1336208

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69326258-69333042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69328267 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 101 (F101L)
Ref Sequence ENSEMBL: ENSMUSP00000018614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018614] [ENSMUST00000060956] [ENSMUST00000092973] [ENSMUST00000102601] [ENSMUST00000102602] [ENSMUST00000108662] [ENSMUST00000123176]
Predicted Effect probably damaging
Transcript: ENSMUST00000018614
AA Change: F101L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018614
Gene: ENSMUSG00000018470
AA Change: F101L

DomainStartEndE-ValueType
low complexity region 23 49 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:Aldo_ket_red 92 396 1.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060956
SMART Domains Protein: ENSMUSP00000050153
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 109 2.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092973
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102601
SMART Domains Protein: ENSMUSP00000099661
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102602
SMART Domains Protein: ENSMUSP00000099662
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108662
SMART Domains Protein: ENSMUSP00000104302
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 127 2.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142328
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. The encoded protein is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. The encoded protein forms a heterodimer with the potassium voltage-gated channel, shaker-related subfamily, member 5 gene product and regulates the activity of the alpha subunit. [provided by RefSeq, May 2012]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Kcnab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Kcnab3 APN 11 69331303 missense probably benign 0.12
IGL01140:Kcnab3 APN 11 69329879 missense probably benign
IGL01642:Kcnab3 APN 11 69330430 missense probably benign
IGL02589:Kcnab3 APN 11 69332102 missense probably benign 0.00
R0046:Kcnab3 UTSW 11 69330227 critical splice donor site probably null
R0046:Kcnab3 UTSW 11 69330227 critical splice donor site probably null
R2247:Kcnab3 UTSW 11 69330190 missense probably damaging 0.99
R3771:Kcnab3 UTSW 11 69328563 missense probably damaging 0.97
R4725:Kcnab3 UTSW 11 69330468 missense probably benign 0.05
R4927:Kcnab3 UTSW 11 69326746 missense possibly damaging 0.51
R6237:Kcnab3 UTSW 11 69328575 missense probably benign 0.24
R7164:Kcnab3 UTSW 11 69331358 critical splice donor site probably null
R7676:Kcnab3 UTSW 11 69326727 missense probably benign
R7880:Kcnab3 UTSW 11 69331464 missense probably damaging 1.00
R7963:Kcnab3 UTSW 11 69331464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAATCCAAGTCCCCAGTGGAGG -3'
(R):5'- TTACGCCGTGCTCATAGGCAAC -3'

Sequencing Primer
(F):5'- AGGCTTCATCCTTTCCTGCTG -3'
(R):5'- TGCTCATAGGCAACTGTCAG -3'
Posted On2013-06-11