Incidental Mutation 'R5737:Tomt'
ID444580
Institutional Source Beutler Lab
Gene Symbol Tomt
Ensembl Gene ENSMUSG00000078630
Gene Nametransmembrane O-methyltransferase
SynonymsComt2, F930017I19Rik
MMRRC Submission 043195-MU
Accession Numbers

Genbank: NM_001081679; MGI: 3707696

Is this an essential gene? Not available question?
Stock #R5737 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101898370-101906359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101900317 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 255 (T255A)
Ref Sequence ENSEMBL: ENSMUSP00000102583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035395] [ENSMUST00000098237] [ENSMUST00000106969] [ENSMUST00000106970] [ENSMUST00000106973] [ENSMUST00000106978] [ENSMUST00000143835] [ENSMUST00000144207] [ENSMUST00000178851] [ENSMUST00000209334] [ENSMUST00000210984]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032884
Predicted Effect probably benign
Transcript: ENSMUST00000035395
SMART Domains Protein: ENSMUSP00000040286
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 21 115 9.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098237
SMART Domains Protein: ENSMUSP00000095839
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 13 104 6.5e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106969
AA Change: T255A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102582
Gene: ENSMUSG00000078630
AA Change: T255A

DomainStartEndE-ValueType
Pfam:Methyltransf_3 64 226 1.2e-16 PFAM
Pfam:Methyltransf_24 103 212 5.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106970
AA Change: T255A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102583
Gene: ENSMUSG00000078630
AA Change: T255A

DomainStartEndE-ValueType
Pfam:Methyltransf_3 65 223 9.1e-19 PFAM
Pfam:Methyltransf_24 103 212 4.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106973
SMART Domains Protein: ENSMUSP00000102586
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 1 95 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106978
SMART Domains Protein: ENSMUSP00000102591
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137949
Predicted Effect probably benign
Transcript: ENSMUST00000143835
SMART Domains Protein: ENSMUSP00000120373
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 6.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144207
SMART Domains Protein: ENSMUSP00000114771
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150018
Predicted Effect probably benign
Transcript: ENSMUST00000178851
SMART Domains Protein: ENSMUSP00000136164
Gene: ENSMUSG00000030649

DomainStartEndE-ValueType
Pfam:ANAPC15 12 106 3.7e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209334
Predicted Effect probably benign
Transcript: ENSMUST00000210984
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene includes two transcript forms. The short form has one open reading frame (ORF), which encodes the leucine-rich repeats (LRR)-containing protein of unknown function. This protein is called LRTOMT1 or LRRC51. The long form has two alternative ORFs; the upstream ORF has the same translation start codon as used in the short form and the resulting transcript is a candidate for nonsense-mediated decay, and the downstream ORF encodes a different protein, which is a transmembrane catechol-O-methyltransferase and is called LRTOMT2, TOMT or COMT2. The COMT2 is essential for auditory and vestibular function. Defects in the COMT2 can cause nonsyndromic deafness. Alternatively spliced transcript variants from each transcript form have been found for this gene. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a mutation of this gene exhibit marked hyperactivity, bidirectional circling and head-tossing. These behaviors are suppressed during sleep and nursing. Homozygous mutant males exhibit heightened male:male aggression. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,559,242 V78A probably damaging Het
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Aldh1l2 T A 10: 83,520,325 D67V probably damaging Het
Ankfy1 T A 11: 72,732,274 D253E probably damaging Het
Arhgap42 T C 9: 9,059,068 K159R probably damaging Het
Atrnl1 C T 19: 57,777,888 A1219V possibly damaging Het
Cacna1c C T 6: 118,741,932 V386I probably damaging Het
Cacna2d2 A G 9: 107,526,747 T1015A possibly damaging Het
Cadps2 T C 6: 23,328,805 M999V probably benign Het
Ccer1 A T 10: 97,694,684 H403L possibly damaging Het
Cubn A T 2: 13,388,891 I1433N probably damaging Het
Dcbld2 T C 16: 58,460,985 V531A probably damaging Het
Dnah11 A G 12: 118,192,390 V175A probably benign Het
Dnah3 T C 7: 120,059,198 K920R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dscaml1 C T 9: 45,745,185 R1608C probably damaging Het
Gtf3c2 A G 5: 31,168,249 probably null Het
Heca A T 10: 17,915,714 M198K possibly damaging Het
Igkv8-24 A T 6: 70,217,138 S29T probably benign Het
Lipo2 A C 19: 33,721,696 N311K probably damaging Het
Lmo7 T G 14: 101,887,236 I266S probably damaging Het
Naip2 T A 13: 100,161,854 E558V probably benign Het
Nelfa T A 5: 33,899,113 probably null Het
Phka2 ACC AC X: 160,559,866 probably null Het
Psmg2 T C 18: 67,646,037 S92P possibly damaging Het
Rasa2 C T 9: 96,570,665 probably null Het
Slc6a3 A C 13: 73,544,804 N181T probably damaging Het
Smim4 A G 14: 31,128,719 I22T probably benign Het
Tdrd5 A G 1: 156,300,724 M136T probably benign Het
Tmem178b A C 6: 40,245,641 M97L possibly damaging Het
Tnfaip8l1 A G 17: 56,171,950 D80G probably benign Het
Vmn2r26 G T 6: 124,039,449 V291F probably benign Het
Other mutations in Tomt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Tomt APN 7 101902186 missense probably benign 0.00
add UTSW 7 101902129 missense probably damaging 1.00
R1913:Tomt UTSW 7 101901247 missense probably damaging 1.00
R6527:Tomt UTSW 7 101900392 missense probably damaging 1.00
R7414:Tomt UTSW 7 101900508 missense probably damaging 1.00
X0018:Tomt UTSW 7 101900571 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCAGTTCCTGATTTTCTATGAGGG -3'
(R):5'- TAAGGGATCTGCAGCTACTGG -3'

Sequencing Primer
(F):5'- CCTTGTAGGACCAAAAAGGCTAATAG -3'
(R):5'- TACTGGAGGCCCATGCTCTG -3'
Posted On2016-11-21