Mutagenetix > Incidental Mutation

Incidental Mutation 'R5737:Aldh1l2'

444587

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

043195-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5737 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83520325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 67 (D67V)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

probably damaging
Transcript: ENSMUST00000020497
AA Change: D180V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: D180V

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

probably damaging
Transcript: ENSMUST00000146640
AA Change: D67V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: D67V

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833439L19Rik	A	G	13: 54,559,242	V78A	probably damaging	Het
5830473C10Rik	G	T	5: 90,572,783	C271F	probably damaging	Het
Ankfy1	T	A	11: 72,732,274	D253E	probably damaging	Het
Arhgap42	T	C	9: 9,059,068	K159R	probably damaging	Het
Atrnl1	C	T	19: 57,777,888	A1219V	possibly damaging	Het
Cacna1c	C	T	6: 118,741,932	V386I	probably damaging	Het
Cacna2d2	A	G	9: 107,526,747	T1015A	possibly damaging	Het
Cadps2	T	C	6: 23,328,805	M999V	probably benign	Het
Ccer1	A	T	10: 97,694,684	H403L	possibly damaging	Het
Cubn	A	T	2: 13,388,891	I1433N	probably damaging	Het
Dcbld2	T	C	16: 58,460,985	V531A	probably damaging	Het
Dnah11	A	G	12: 118,192,390	V175A	probably benign	Het
Dnah3	T	C	7: 120,059,198	K920R	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dscaml1	C	T	9: 45,745,185	R1608C	probably damaging	Het
Gtf3c2	A	G	5: 31,168,249		probably null	Het
Heca	A	T	10: 17,915,714	M198K	possibly damaging	Het
Igkv8-24	A	T	6: 70,217,138	S29T	probably benign	Het
Lipo2	A	C	19: 33,721,696	N311K	probably damaging	Het
Lmo7	T	G	14: 101,887,236	I266S	probably damaging	Het
Naip2	T	A	13: 100,161,854	E558V	probably benign	Het
Nelfa	T	A	5: 33,899,113		probably null	Het
Phka2	ACC	AC	X: 160,559,866		probably null	Het
Psmg2	T	C	18: 67,646,037	S92P	possibly damaging	Het
Rasa2	C	T	9: 96,570,665		probably null	Het
Slc6a3	A	C	13: 73,544,804	N181T	probably damaging	Het
Smim4	A	G	14: 31,128,719	I22T	probably benign	Het
Tdrd5	A	G	1: 156,300,724	M136T	probably benign	Het
Tmem178b	A	C	6: 40,245,641	M97L	possibly damaging	Het
Tnfaip8l1	A	G	17: 56,171,950	D80G	probably benign	Het
Tomt	T	C	7: 101,900,317	T255A	probably benign	Het
Vmn2r26	G	T	6: 124,039,449	V291F	probably benign	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CGTCACAGACTTTCAAGCTCC -3'
(R):5'- TAGGCCACTATCTGCGTTTG -3'

Sequencing Primer
(F):5'- GCTCCAATTTACATTACAGCCATGTG -3'
(R):5'- GCGTTTGCAATGTAACCTCC -3'

Posted On

2016-11-21