Incidental Mutation 'R5737:Ccer1'
ID444588
Institutional Source Beutler Lab
Gene Symbol Ccer1
Ensembl Gene ENSMUSG00000047025
Gene Namecoiled-coil glutamate-rich protein 1
Synonyms
MMRRC Submission 043195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5737 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location97693059-97694923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97694684 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 403 (H403L)
Ref Sequence ENSEMBL: ENSMUSP00000050554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060703]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060703
AA Change: H403L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050554
Gene: ENSMUSG00000047025
AA Change: H403L

DomainStartEndE-ValueType
Pfam:CCER1 4 218 5.9e-123 PFAM
coiled coil region 292 323 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220233
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,559,242 V78A probably damaging Het
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Aldh1l2 T A 10: 83,520,325 D67V probably damaging Het
Ankfy1 T A 11: 72,732,274 D253E probably damaging Het
Arhgap42 T C 9: 9,059,068 K159R probably damaging Het
Atrnl1 C T 19: 57,777,888 A1219V possibly damaging Het
Cacna1c C T 6: 118,741,932 V386I probably damaging Het
Cacna2d2 A G 9: 107,526,747 T1015A possibly damaging Het
Cadps2 T C 6: 23,328,805 M999V probably benign Het
Cubn A T 2: 13,388,891 I1433N probably damaging Het
Dcbld2 T C 16: 58,460,985 V531A probably damaging Het
Dnah11 A G 12: 118,192,390 V175A probably benign Het
Dnah3 T C 7: 120,059,198 K920R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dscaml1 C T 9: 45,745,185 R1608C probably damaging Het
Gtf3c2 A G 5: 31,168,249 probably null Het
Heca A T 10: 17,915,714 M198K possibly damaging Het
Igkv8-24 A T 6: 70,217,138 S29T probably benign Het
Lipo2 A C 19: 33,721,696 N311K probably damaging Het
Lmo7 T G 14: 101,887,236 I266S probably damaging Het
Naip2 T A 13: 100,161,854 E558V probably benign Het
Nelfa T A 5: 33,899,113 probably null Het
Phka2 ACC AC X: 160,559,866 probably null Het
Psmg2 T C 18: 67,646,037 S92P possibly damaging Het
Rasa2 C T 9: 96,570,665 probably null Het
Slc6a3 A C 13: 73,544,804 N181T probably damaging Het
Smim4 A G 14: 31,128,719 I22T probably benign Het
Tdrd5 A G 1: 156,300,724 M136T probably benign Het
Tmem178b A C 6: 40,245,641 M97L possibly damaging Het
Tnfaip8l1 A G 17: 56,171,950 D80G probably benign Het
Tomt T C 7: 101,900,317 T255A probably benign Het
Vmn2r26 G T 6: 124,039,449 V291F probably benign Het
Other mutations in Ccer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Ccer1 APN 10 97694539 missense probably benign 0.18
IGL01434:Ccer1 APN 10 97693597 missense unknown
IGL01895:Ccer1 APN 10 97694050 missense unknown
IGL02030:Ccer1 APN 10 97693610 missense unknown
IGL02962:Ccer1 APN 10 97693840 missense unknown
IGL03352:Ccer1 APN 10 97693577 missense unknown
R1083:Ccer1 UTSW 10 97694658 missense possibly damaging 0.70
R1911:Ccer1 UTSW 10 97694677 missense possibly damaging 0.53
R3769:Ccer1 UTSW 10 97694552 missense probably damaging 1.00
R4364:Ccer1 UTSW 10 97694370 small deletion probably benign
R7154:Ccer1 UTSW 10 97694339 missense unknown
R7173:Ccer1 UTSW 10 97693355 start gained probably benign
R7413:Ccer1 UTSW 10 97693942 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCTCCTACCCCAGGGCT -3'
(R):5'- AATATATCCGAAATCTTCCCCTCCC -3'

Sequencing Primer
(F):5'- AAATGTTGATGATGATGAGTGTGAC -3'
(R):5'- TCCCCCACCCATAGTCATAC -3'
Posted On2016-11-21