Incidental Mutation 'R5737:4833439L19Rik'
ID444591
Institutional Source Beutler Lab
Gene Symbol 4833439L19Rik
Ensembl Gene ENSMUSG00000025871
Gene NameRIKEN cDNA 4833439L19 gene
Synonyms
MMRRC Submission 043195-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5737 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location54551218-54565435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54559242 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 78 (V78A)
Ref Sequence ENSEMBL: ENSMUSP00000119874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026989] [ENSMUST00000126295] [ENSMUST00000132136] [ENSMUST00000143144] [ENSMUST00000153065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026989
AA Change: V97A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026989
Gene: ENSMUSG00000025871
AA Change: V97A

DomainStartEndE-ValueType
Pfam:P33MONOX 15 303 5.8e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126295
Predicted Effect probably benign
Transcript: ENSMUST00000132136
SMART Domains Protein: ENSMUSP00000121083
Gene: ENSMUSG00000025871

DomainStartEndE-ValueType
Pfam:P33MONOX 14 69 4.3e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143144
AA Change: V97A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120615
Gene: ENSMUSG00000025871
AA Change: V97A

DomainStartEndE-ValueType
Pfam:P33MONOX 14 133 9.7e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150938
Predicted Effect probably damaging
Transcript: ENSMUST00000153065
AA Change: V78A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119874
Gene: ENSMUSG00000025871
AA Change: V78A

DomainStartEndE-ValueType
Pfam:P33MONOX 1 284 7e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153708
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Aldh1l2 T A 10: 83,520,325 D67V probably damaging Het
Ankfy1 T A 11: 72,732,274 D253E probably damaging Het
Arhgap42 T C 9: 9,059,068 K159R probably damaging Het
Atrnl1 C T 19: 57,777,888 A1219V possibly damaging Het
Cacna1c C T 6: 118,741,932 V386I probably damaging Het
Cacna2d2 A G 9: 107,526,747 T1015A possibly damaging Het
Cadps2 T C 6: 23,328,805 M999V probably benign Het
Ccer1 A T 10: 97,694,684 H403L possibly damaging Het
Cubn A T 2: 13,388,891 I1433N probably damaging Het
Dcbld2 T C 16: 58,460,985 V531A probably damaging Het
Dnah11 A G 12: 118,192,390 V175A probably benign Het
Dnah3 T C 7: 120,059,198 K920R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dscaml1 C T 9: 45,745,185 R1608C probably damaging Het
Gtf3c2 A G 5: 31,168,249 probably null Het
Heca A T 10: 17,915,714 M198K possibly damaging Het
Igkv8-24 A T 6: 70,217,138 S29T probably benign Het
Lipo2 A C 19: 33,721,696 N311K probably damaging Het
Lmo7 T G 14: 101,887,236 I266S probably damaging Het
Naip2 T A 13: 100,161,854 E558V probably benign Het
Nelfa T A 5: 33,899,113 probably null Het
Phka2 ACC AC X: 160,559,866 probably null Het
Psmg2 T C 18: 67,646,037 S92P possibly damaging Het
Rasa2 C T 9: 96,570,665 probably null Het
Slc6a3 A C 13: 73,544,804 N181T probably damaging Het
Smim4 A G 14: 31,128,719 I22T probably benign Het
Tdrd5 A G 1: 156,300,724 M136T probably benign Het
Tmem178b A C 6: 40,245,641 M97L possibly damaging Het
Tnfaip8l1 A G 17: 56,171,950 D80G probably benign Het
Tomt T C 7: 101,900,317 T255A probably benign Het
Vmn2r26 G T 6: 124,039,449 V291F probably benign Het
Other mutations in 4833439L19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:4833439L19Rik APN 13 54556525 critical splice donor site probably null
IGL02819:4833439L19Rik APN 13 54564220 intron probably benign
IGL02935:4833439L19Rik APN 13 54561862 missense possibly damaging 0.90
R0508:4833439L19Rik UTSW 13 54553050 unclassified probably null
R3900:4833439L19Rik UTSW 13 54552968 missense probably damaging 0.99
R5091:4833439L19Rik UTSW 13 54553244 missense probably damaging 1.00
R7283:4833439L19Rik UTSW 13 54552691 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTAGGAATACACCTAAGCCAATGAG -3'
(R):5'- GTTGCACACTCTCGTAACGTTC -3'

Sequencing Primer
(F):5'- GTCAATGAGATCCTTCATAGTCAAC -3'
(R):5'- TCGTAACGTTCTCCACAGACGTAAG -3'
Posted On2016-11-21