Incidental Mutation 'R5737:Slc6a3'
ID444592
Institutional Source Beutler Lab
Gene Symbol Slc6a3
Ensembl Gene ENSMUSG00000021609
Gene Namesolute carrier family 6 (neurotransmitter transporter, dopamine), member 3
SynonymsDat1, DAT
MMRRC Submission 043195-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5737 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location73536747-73578672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73544804 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 181 (N181T)
Ref Sequence ENSEMBL: ENSMUSP00000022100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022100]
Predicted Effect probably damaging
Transcript: ENSMUST00000022100
AA Change: N181T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609
AA Change: N181T

DomainStartEndE-ValueType
Pfam:SNF 60 582 8.1e-237 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,559,242 V78A probably damaging Het
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Aldh1l2 T A 10: 83,520,325 D67V probably damaging Het
Ankfy1 T A 11: 72,732,274 D253E probably damaging Het
Arhgap42 T C 9: 9,059,068 K159R probably damaging Het
Atrnl1 C T 19: 57,777,888 A1219V possibly damaging Het
Cacna1c C T 6: 118,741,932 V386I probably damaging Het
Cacna2d2 A G 9: 107,526,747 T1015A possibly damaging Het
Cadps2 T C 6: 23,328,805 M999V probably benign Het
Ccer1 A T 10: 97,694,684 H403L possibly damaging Het
Cubn A T 2: 13,388,891 I1433N probably damaging Het
Dcbld2 T C 16: 58,460,985 V531A probably damaging Het
Dnah11 A G 12: 118,192,390 V175A probably benign Het
Dnah3 T C 7: 120,059,198 K920R probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dscaml1 C T 9: 45,745,185 R1608C probably damaging Het
Gtf3c2 A G 5: 31,168,249 probably null Het
Heca A T 10: 17,915,714 M198K possibly damaging Het
Igkv8-24 A T 6: 70,217,138 S29T probably benign Het
Lipo2 A C 19: 33,721,696 N311K probably damaging Het
Lmo7 T G 14: 101,887,236 I266S probably damaging Het
Naip2 T A 13: 100,161,854 E558V probably benign Het
Nelfa T A 5: 33,899,113 probably null Het
Phka2 ACC AC X: 160,559,866 probably null Het
Psmg2 T C 18: 67,646,037 S92P possibly damaging Het
Rasa2 C T 9: 96,570,665 probably null Het
Smim4 A G 14: 31,128,719 I22T probably benign Het
Tdrd5 A G 1: 156,300,724 M136T probably benign Het
Tmem178b A C 6: 40,245,641 M97L possibly damaging Het
Tnfaip8l1 A G 17: 56,171,950 D80G probably benign Het
Tomt T C 7: 101,900,317 T255A probably benign Het
Vmn2r26 G T 6: 124,039,449 V291F probably benign Het
Other mutations in Slc6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc6a3 APN 13 73544741 missense probably damaging 1.00
IGL01524:Slc6a3 APN 13 73538549 missense probably benign 0.01
IGL02015:Slc6a3 APN 13 73544714 missense possibly damaging 0.60
IGL03008:Slc6a3 APN 13 73558285 critical splice donor site probably null
IGL03029:Slc6a3 APN 13 73538697 missense probably damaging 1.00
IGL03064:Slc6a3 APN 13 73571466 missense probably damaging 0.99
IGL03272:Slc6a3 APN 13 73540929 missense probably damaging 0.98
IGL03294:Slc6a3 APN 13 73557181 critical splice donor site probably null
IGL03345:Slc6a3 APN 13 73571514 missense probably benign
IGL03410:Slc6a3 APN 13 73538657 missense probably benign 0.03
disney UTSW 13 73544884 missense probably benign
dopey UTSW 13 73560959 missense probably damaging 1.00
Dopey2 UTSW 13 73544817 missense probably damaging 1.00
Stiff UTSW 13 73557050 missense possibly damaging 0.85
PIT4382001:Slc6a3 UTSW 13 73571523 missense probably benign 0.35
R0024:Slc6a3 UTSW 13 73540837 splice site probably benign
R0125:Slc6a3 UTSW 13 73569979 splice site probably benign
R0180:Slc6a3 UTSW 13 73562336 missense probably damaging 1.00
R0288:Slc6a3 UTSW 13 73560928 missense probably damaging 1.00
R0322:Slc6a3 UTSW 13 73560926 missense possibly damaging 0.61
R0349:Slc6a3 UTSW 13 73567557 missense probably damaging 1.00
R0411:Slc6a3 UTSW 13 73557050 missense possibly damaging 0.85
R0594:Slc6a3 UTSW 13 73538642 missense probably damaging 0.99
R0680:Slc6a3 UTSW 13 73538727 missense probably damaging 1.00
R1099:Slc6a3 UTSW 13 73567641 missense probably benign 0.21
R1109:Slc6a3 UTSW 13 73557080 missense probably benign 0.00
R1791:Slc6a3 UTSW 13 73566292 missense possibly damaging 0.82
R3916:Slc6a3 UTSW 13 73562308 missense probably benign 0.00
R4279:Slc6a3 UTSW 13 73544834 missense possibly damaging 0.90
R4368:Slc6a3 UTSW 13 73560912 nonsense probably null
R4520:Slc6a3 UTSW 13 73540856 missense possibly damaging 0.95
R4666:Slc6a3 UTSW 13 73538581 missense possibly damaging 0.47
R4675:Slc6a3 UTSW 13 73544817 missense probably damaging 1.00
R4716:Slc6a3 UTSW 13 73557076 missense probably benign 0.04
R5243:Slc6a3 UTSW 13 73571451 missense possibly damaging 0.61
R5355:Slc6a3 UTSW 13 73560959 missense probably damaging 1.00
R5681:Slc6a3 UTSW 13 73538735 missense probably damaging 0.99
R6142:Slc6a3 UTSW 13 73544783 missense probably benign 0.00
R6471:Slc6a3 UTSW 13 73544884 missense probably benign
R7168:Slc6a3 UTSW 13 73571472 missense probably benign 0.00
R7403:Slc6a3 UTSW 13 73562427 critical splice donor site probably null
R8282:Slc6a3 UTSW 13 73557081 missense probably benign 0.01
R8359:Slc6a3 UTSW 13 73544883 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGCAAGGGATGTCAATGC -3'
(R):5'- TCCTCTGTGTCGAAACTGAGTTC -3'

Sequencing Primer
(F):5'- GATGTCAATGCACCAGCTCAGG -3'
(R):5'- TGTGTCGAAACTGAGTTCCCAGAC -3'
Posted On2016-11-21