Mutagenetix > Incidental Mutations

Incidental Mutation 'R5737:Lmo7'

444595

Institutional Source

Beutler Lab

Gene Symbol

Lmo7

Ensembl Gene

ENSMUSG00000033060

Gene Name

LIM domain only 7

Synonyms

FBXO20, LOC380928

MMRRC Submission

043195-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R5737 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101729957-101934710 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 101887236 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 266 (I266S)

Ref Sequence

ENSEMBL: ENSMUSP00000124349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]

Predicted Effect

probably damaging
Transcript: ENSMUST00000100337
AA Change: I499S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: I499S

Domain	Start	End	E-Value	Type
CH	14	124	2.57e-13	SMART
low complexity region	200	211	N/A	INTRINSIC
Pfam:DUF4757	242	348	2.2e-14	PFAM
low complexity region	448	462	N/A	INTRINSIC
Pfam:DUF4757	568	735	1.8e-46	PFAM
low complexity region	861	879	N/A	INTRINSIC
low complexity region	979	991	N/A	INTRINSIC
low complexity region	1003	1015	N/A	INTRINSIC
PDZ	1047	1119	1.05e-8	SMART
coiled coil region	1222	1275	N/A	INTRINSIC
coiled coil region	1319	1411	N/A	INTRINSIC
low complexity region	1585	1596	N/A	INTRINSIC
low complexity region	1599	1617	N/A	INTRINSIC
LIM	1629	1687	6.54e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159026
AA Change: I266S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060
AA Change: I266S

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	471	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159258
AA Change: I266S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060
AA Change: I266S

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159314
AA Change: I266S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060
AA Change: I266S

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	492	N/A	INTRINSIC
low complexity region	628	646	N/A	INTRINSIC
low complexity region	746	758	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
PDZ	814	886	1.05e-8	SMART
coiled coil region	989	1042	N/A	INTRINSIC
coiled coil region	1086	1178	N/A	INTRINSIC
low complexity region	1352	1363	N/A	INTRINSIC
low complexity region	1366	1384	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000159597
AA Change: I377S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: I377S

Domain	Start	End	E-Value	Type
low complexity region	78	89	N/A	INTRINSIC
internal_repeat_1	111	141	6.96e-5	PROSPERO
internal_repeat_1	218	248	6.96e-5	PROSPERO
low complexity region	326	340	N/A	INTRINSIC
coiled coil region	546	603	N/A	INTRINSIC
low complexity region	739	757	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	881	893	N/A	INTRINSIC
PDZ	925	997	1.05e-8	SMART
coiled coil region	1127	1180	N/A	INTRINSIC
coiled coil region	1224	1316	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1504	1522	N/A	INTRINSIC
LIM	1534	1592	6.54e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159797

Predicted Effect

probably benign
Transcript: ENSMUST00000159806

SMART Domains

Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
Pfam:DUF4757	76	225	4.5e-53	PFAM
low complexity region	351	369	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	493	505	N/A	INTRINSIC
PDZ	537	609	1.05e-8	SMART
internal_repeat_1	620	691	9.31e-5	PROSPERO
coiled coil region	711	764	N/A	INTRINSIC
coiled coil region	808	900	N/A	INTRINSIC
internal_repeat_1	921	976	9.31e-5	PROSPERO
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1089	1107	N/A	INTRINSIC
LIM	1119	1177	6.54e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159948

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160876

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161668

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162091

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833439L19Rik	A	G	13: 54,559,242	V78A	probably damaging	Het
5830473C10Rik	G	T	5: 90,572,783	C271F	probably damaging	Het
Aldh1l2	T	A	10: 83,520,325	D67V	probably damaging	Het
Ankfy1	T	A	11: 72,732,274	D253E	probably damaging	Het
Arhgap42	T	C	9: 9,059,068	K159R	probably damaging	Het
Atrnl1	C	T	19: 57,777,888	A1219V	possibly damaging	Het
Cacna1c	C	T	6: 118,741,932	V386I	probably damaging	Het
Cacna2d2	A	G	9: 107,526,747	T1015A	possibly damaging	Het
Cadps2	T	C	6: 23,328,805	M999V	probably benign	Het
Ccer1	A	T	10: 97,694,684	H403L	possibly damaging	Het
Cubn	A	T	2: 13,388,891	I1433N	probably damaging	Het
Dcbld2	T	C	16: 58,460,985	V531A	probably damaging	Het
Dnah11	A	G	12: 118,192,390	V175A	probably benign	Het
Dnah3	T	C	7: 120,059,198	K920R	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dscaml1	C	T	9: 45,745,185	R1608C	probably damaging	Het
Gtf3c2	A	G	5: 31,168,249		probably null	Het
Heca	A	T	10: 17,915,714	M198K	possibly damaging	Het
Igkv8-24	A	T	6: 70,217,138	S29T	probably benign	Het
Lipo2	A	C	19: 33,721,696	N311K	probably damaging	Het
Naip2	T	A	13: 100,161,854	E558V	probably benign	Het
Nelfa	T	A	5: 33,899,113		probably null	Het
Phka2	ACC	AC	X: 160,559,866		probably null	Het
Psmg2	T	C	18: 67,646,037	S92P	possibly damaging	Het
Rasa2	C	T	9: 96,570,665		probably null	Het
Slc6a3	A	C	13: 73,544,804	N181T	probably damaging	Het
Smim4	A	G	14: 31,128,719	I22T	probably benign	Het
Tdrd5	A	G	1: 156,300,724	M136T	probably benign	Het
Tmem178b	A	C	6: 40,245,641	M97L	possibly damaging	Het
Tnfaip8l1	A	G	17: 56,171,950	D80G	probably benign	Het
Tomt	T	C	7: 101,900,317	T255A	probably benign	Het
Vmn2r26	G	T	6: 124,039,449	V291F	probably benign	Het

Other mutations in Lmo7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Lmo7	APN	14	101887051	missense	probably damaging	0.99
IGL00733:Lmo7	APN	14	101915702	missense	probably damaging	1.00
IGL00778:Lmo7	APN	14	101910885	splice site	probably benign
IGL01014:Lmo7	APN	14	101920557	splice site	probably benign
IGL01401:Lmo7	APN	14	101794277	nonsense	probably null
IGL01550:Lmo7	APN	14	101926140	utr 3 prime	probably benign
IGL01570:Lmo7	APN	14	101902371	critical splice donor site	probably null
IGL01602:Lmo7	APN	14	101910756	splice site	probably benign
IGL01605:Lmo7	APN	14	101910756	splice site	probably benign
IGL02012:Lmo7	APN	14	101888716	intron	probably benign
IGL02145:Lmo7	APN	14	101902223	missense	probably benign	0.00
IGL02236:Lmo7	APN	14	101926088	splice site	probably benign
IGL02318:Lmo7	APN	14	101900066	splice site	probably benign
IGL02345:Lmo7	APN	14	101887473	missense	probably damaging	1.00
IGL02498:Lmo7	APN	14	101807482	missense	probably benign	0.01
IGL02583:Lmo7	APN	14	101933924	utr 3 prime	probably benign
IGL02670:Lmo7	APN	14	101880980	missense	probably damaging	1.00
IGL02694:Lmo7	APN	14	101887170	missense	probably damaging	1.00
IGL03026:Lmo7	APN	14	101929333	utr 3 prime	probably benign
IGL03062:Lmo7	APN	14	101912079	missense	possibly damaging	0.66
IGL03068:Lmo7	APN	14	101875492	unclassified	probably benign
IGL03178:Lmo7	APN	14	101929260	nonsense	probably null
IGL03279:Lmo7	APN	14	101900508	missense	probably benign	0.30
PIT4458001:Lmo7	UTSW	14	101887487	nonsense	probably null
R0029:Lmo7	UTSW	14	101933921	utr 3 prime	probably benign
R0112:Lmo7	UTSW	14	101887193	nonsense	probably null
R0345:Lmo7	UTSW	14	101876877	missense	probably damaging	1.00
R0372:Lmo7	UTSW	14	101918053	splice site	probably benign
R0393:Lmo7	UTSW	14	101900456	missense	probably benign
R0514:Lmo7	UTSW	14	101887173	missense	probably damaging	1.00
R0514:Lmo7	UTSW	14	101896559	missense	probably damaging	1.00
R0526:Lmo7	UTSW	14	101900560	missense	probably damaging	1.00
R0615:Lmo7	UTSW	14	101876859	nonsense	probably null
R0900:Lmo7	UTSW	14	101887188	missense	probably damaging	1.00
R0961:Lmo7	UTSW	14	101794269	missense	probably benign	0.00
R0964:Lmo7	UTSW	14	101920567	splice site	probably benign
R1078:Lmo7	UTSW	14	101920474	splice site	probably benign
R1252:Lmo7	UTSW	14	101900583	missense	probably damaging	1.00
R1527:Lmo7	UTSW	14	101876828	missense	probably damaging	1.00
R1537:Lmo7	UTSW	14	101929264	utr 3 prime	probably benign
R1565:Lmo7	UTSW	14	101887521	missense	probably damaging	0.99
R1637:Lmo7	UTSW	14	101880832	missense	probably damaging	1.00
R1943:Lmo7	UTSW	14	101902302	missense	probably damaging	1.00
R1967:Lmo7	UTSW	14	101900215	missense	probably benign	0.36
R2002:Lmo7	UTSW	14	101887061	missense	probably benign	0.13
R2057:Lmo7	UTSW	14	101887178	missense	probably damaging	1.00
R2131:Lmo7	UTSW	14	101900238	missense	probably damaging	0.99
R2153:Lmo7	UTSW	14	101920515	utr 3 prime	probably benign
R2257:Lmo7	UTSW	14	101900130	missense	probably damaging	1.00
R2355:Lmo7	UTSW	14	101888685	missense	probably damaging	1.00
R2356:Lmo7	UTSW	14	101886945	missense	probably damaging	1.00
R2898:Lmo7	UTSW	14	101876914	missense	possibly damaging	0.93
R3847:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3848:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3849:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3916:Lmo7	UTSW	14	101929342	utr 3 prime	probably benign
R4050:Lmo7	UTSW	14	101902277	nonsense	probably null
R4326:Lmo7	UTSW	14	101900074	missense	possibly damaging	0.93
R4357:Lmo7	UTSW	14	101887655	missense	probably null	1.00
R4571:Lmo7	UTSW	14	101887594	missense	probably damaging	0.96
R4658:Lmo7	UTSW	14	101886957	missense	probably damaging	1.00
R4857:Lmo7	UTSW	14	101887348	intron	probably null
R5006:Lmo7	UTSW	14	101926237	utr 3 prime	probably benign
R5528:Lmo7	UTSW	14	101902086	missense	probably damaging	1.00
R5588:Lmo7	UTSW	14	101896590	splice site	probably null
R5643:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5644:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5650:Lmo7	UTSW	14	101898674	missense	probably damaging	1.00
R5832:Lmo7	UTSW	14	101884213	missense	probably damaging	1.00
R5966:Lmo7	UTSW	14	101900502	missense	possibly damaging	0.92
R6026:Lmo7	UTSW	14	101880990	missense	probably benign	0.04
R6072:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R6158:Lmo7	UTSW	14	101900137	missense	probably benign	0.03
R6246:Lmo7	UTSW	14	101918700	missense	probably damaging	1.00
R6335:Lmo7	UTSW	14	101900636	missense	probably damaging	1.00
R6620:Lmo7	UTSW	14	101875452	missense	probably benign	0.29
R6658:Lmo7	UTSW	14	101910845	missense	possibly damaging	0.84
R6917:Lmo7	UTSW	14	101918010	missense	probably damaging	1.00
R7064:Lmo7	UTSW	14	101884179	missense	probably damaging	1.00
R7072:Lmo7	UTSW	14	101898700	critical splice donor site	probably null
R7121:Lmo7	UTSW	14	101887035	missense	probably damaging	1.00
R7136:Lmo7	UTSW	14	101920539	missense	unknown
R7196:Lmo7	UTSW	14	101896500	missense	possibly damaging	0.75
R7228:Lmo7	UTSW	14	101896535	missense	probably damaging	0.99
R7337:Lmo7	UTSW	14	101884204	missense	probably damaging	0.98
R7341:Lmo7	UTSW	14	101885512	missense	probably benign	0.30
R7408:Lmo7	UTSW	14	101880953	missense	probably damaging	1.00
R7432:Lmo7	UTSW	14	101902115	missense	probably benign	0.42
R7470:Lmo7	UTSW	14	101900604	missense	possibly damaging	0.83
R7506:Lmo7	UTSW	14	101919609	missense	unknown
R7559:Lmo7	UTSW	14	101887226	nonsense	probably null
R7565:Lmo7	UTSW	14	101885301	missense	probably damaging	0.98
R7788:Lmo7	UTSW	14	101898576	missense	possibly damaging	0.64
X0066:Lmo7	UTSW	14	101887461	missense	probably damaging	1.00
X0067:Lmo7	UTSW	14	101886933	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TCATAACTCGCAGGAAGAATCG -3'
(R):5'- TGTCCTTTCGAGCACAGAGAG -3'

Sequencing Primer
(F):5'- TCGCAGGAAGAATCGCTCTC -3'
(R):5'- CAGAGAGAAACTTCGCTTGGATTTC -3'

Posted On

2016-11-21