Incidental Mutation 'R5738:Glmp'
ID 444612
Institutional Source Beutler Lab
Gene Symbol Glmp
Ensembl Gene ENSMUSG00000001418
Gene Name glycosylated lysosomal membrane protein
Synonyms 0610031J06Rik, NCU-G1
MMRRC Submission 043350-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5738 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 88232330-88235938 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88233445 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 133 (N133K)
Ref Sequence ENSEMBL: ENSMUSP00000135398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001452] [ENSMUST00000001454] [ENSMUST00000001456] [ENSMUST00000107552] [ENSMUST00000107553] [ENSMUST00000131666] [ENSMUST00000176425] [ENSMUST00000154381] [ENSMUST00000164166] [ENSMUST00000176519] [ENSMUST00000168062] [ENSMUST00000177005]
AlphaFold Q9JHJ3
Predicted Effect probably benign
Transcript: ENSMUST00000001452
SMART Domains Protein: ENSMUSP00000001452
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 527 3.2e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001454
SMART Domains Protein: ENSMUSP00000001454
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 130 2.7e-26 PFAM
Pfam:NCU-G1 124 333 4.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001456
SMART Domains Protein: ENSMUSP00000001456
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107552
SMART Domains Protein: ENSMUSP00000103176
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107553
SMART Domains Protein: ENSMUSP00000103177
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131666
SMART Domains Protein: ENSMUSP00000120235
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153716
Predicted Effect probably benign
Transcript: ENSMUST00000176425
AA Change: N48K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000135575
Gene: ENSMUSG00000001418
AA Change: N48K

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 37 314 3.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164122
Predicted Effect probably benign
Transcript: ENSMUST00000154381
SMART Domains Protein: ENSMUSP00000134809
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
Pfam:NCU-G1 2 72 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168971
SMART Domains Protein: ENSMUSP00000131250
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 38 5.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164166
SMART Domains Protein: ENSMUSP00000126109
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 15 489 1.7e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176519
SMART Domains Protein: ENSMUSP00000135263
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 125 4.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168062
SMART Domains Protein: ENSMUSP00000131113
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 520 2.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177005
AA Change: N133K

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135398
Gene: ENSMUSG00000001418
AA Change: N133K

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 54 397 1.1e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193646
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Homozygous mutants for this allele displayed spontaneous development of liver fibrosis at 6 months and various hepatic cell phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,571,917 (GRCm39) D4826V probably damaging Het
Acoxl G A 2: 127,719,686 (GRCm39) C149Y probably benign Het
Adamts3 G T 5: 89,856,527 (GRCm39) H349N probably damaging Het
Ap2b1 A G 11: 83,227,256 (GRCm39) probably null Het
Ap3m2 T C 8: 23,293,877 (GRCm39) S58G possibly damaging Het
Bhmt2 A T 13: 93,799,798 (GRCm39) W213R probably benign Het
Cacna1h T G 17: 25,606,023 (GRCm39) D1092A probably damaging Het
Cbfb A C 8: 105,929,193 (GRCm39) Q170P probably damaging Het
Ccdc73 A C 2: 104,761,331 (GRCm39) K110N possibly damaging Het
Cep350 C A 1: 155,741,824 (GRCm39) R2149L probably damaging Het
Cog2 A G 8: 125,272,777 (GRCm39) T525A probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Fbxl5 A G 5: 43,920,170 (GRCm39) I251T probably benign Het
Fscn3 A G 6: 28,430,030 (GRCm39) K67E possibly damaging Het
Gpr179 T C 11: 97,242,232 (GRCm39) N204S probably damaging Het
Gtf2ird1 C T 5: 134,412,672 (GRCm39) R613Q probably damaging Het
Hepacam A G 9: 37,294,721 (GRCm39) D285G possibly damaging Het
Hipk4 G A 7: 27,227,841 (GRCm39) V196M probably damaging Het
Hlx A T 1: 184,463,754 (GRCm39) probably null Het
Igf2r A T 17: 12,936,254 (GRCm39) D597E probably benign Het
Ighm T C 12: 113,385,115 (GRCm39) T282A unknown Het
Igsf9b T C 9: 27,239,826 (GRCm39) C624R probably damaging Het
Ksr2 T C 5: 117,886,864 (GRCm39) V800A probably damaging Het
Lyn A T 4: 3,782,987 (GRCm39) I386F probably damaging Het
Melk A G 4: 44,310,333 (GRCm39) D102G probably damaging Het
Mettl1 G T 10: 126,877,863 (GRCm39) E4* probably null Het
Mybl2 C T 2: 162,910,203 (GRCm39) Q210* probably null Het
Naga C T 15: 82,219,054 (GRCm39) W231* probably null Het
Or2y3 T C 17: 38,393,347 (GRCm39) Y174C probably damaging Het
Or4k2 C T 14: 50,424,105 (GRCm39) V190I probably benign Het
Or7g16 T C 9: 18,727,125 (GRCm39) N155S possibly damaging Het
Otud4 T C 8: 80,400,090 (GRCm39) S935P probably benign Het
P2rx7 C T 5: 122,790,852 (GRCm39) T63I probably damaging Het
Pga5 A T 19: 10,647,024 (GRCm39) N260K probably benign Het
Phka2 ACC AC X: 159,342,862 (GRCm39) probably null Het
Plch1 T A 3: 63,681,076 (GRCm39) R184W probably damaging Het
Ppm1b T C 17: 85,301,374 (GRCm39) F85L probably benign Het
Prtg T A 9: 72,819,288 (GRCm39) F1094I probably benign Het
Ralgds G A 2: 28,432,538 (GRCm39) probably benign Het
Rgs17 A C 10: 5,783,140 (GRCm39) V149G probably damaging Het
Rnf168 A G 16: 32,101,192 (GRCm39) E124G probably damaging Het
Sav1 T C 12: 70,022,817 (GRCm39) E245G possibly damaging Het
Slc25a19 T C 11: 115,515,060 (GRCm39) I33V probably benign Het
Sptbn1 T C 11: 30,095,941 (GRCm39) I318V probably damaging Het
Tas2r136 A G 6: 132,754,707 (GRCm39) L140P probably damaging Het
Tbc1d9 A G 8: 83,997,655 (GRCm39) I1071V probably benign Het
Tecta G T 9: 42,284,474 (GRCm39) N870K possibly damaging Het
Tmem230 G A 2: 132,086,048 (GRCm39) P38L possibly damaging Het
Trpa1 G T 1: 14,946,174 (GRCm39) H986N probably damaging Het
Wdr41 A T 13: 95,114,996 (GRCm39) I24L possibly damaging Het
Other mutations in Glmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Glmp APN 3 88,233,169 (GRCm39) splice site probably null
IGL02551:Glmp APN 3 88,232,389 (GRCm39) start codon destroyed probably null 0.53
IGL03212:Glmp APN 3 88,235,664 (GRCm39) missense probably benign 0.01
R0325:Glmp UTSW 3 88,232,391 (GRCm39) start codon destroyed probably null 0.72
R0719:Glmp UTSW 3 88,233,452 (GRCm39) nonsense probably null
R0721:Glmp UTSW 3 88,233,452 (GRCm39) nonsense probably null
R1617:Glmp UTSW 3 88,235,426 (GRCm39) splice site probably benign
R1970:Glmp UTSW 3 88,235,177 (GRCm39) missense probably damaging 1.00
R3824:Glmp UTSW 3 88,233,718 (GRCm39) missense probably damaging 1.00
R3825:Glmp UTSW 3 88,233,718 (GRCm39) missense probably damaging 1.00
R4521:Glmp UTSW 3 88,235,346 (GRCm39) missense possibly damaging 0.60
R4697:Glmp UTSW 3 88,235,581 (GRCm39) missense probably damaging 0.99
R4806:Glmp UTSW 3 88,233,320 (GRCm39) intron probably benign
R4823:Glmp UTSW 3 88,232,530 (GRCm39) intron probably benign
R5035:Glmp UTSW 3 88,233,951 (GRCm39) splice site probably benign
R5043:Glmp UTSW 3 88,233,983 (GRCm39) intron probably benign
R5335:Glmp UTSW 3 88,233,962 (GRCm39) intron probably benign
R5592:Glmp UTSW 3 88,233,333 (GRCm39) intron probably benign
R5921:Glmp UTSW 3 88,233,283 (GRCm39) missense probably benign 0.09
R6046:Glmp UTSW 3 88,232,495 (GRCm39) missense probably damaging 0.96
R6103:Glmp UTSW 3 88,235,338 (GRCm39) missense probably benign 0.02
R6859:Glmp UTSW 3 88,235,349 (GRCm39) missense probably benign 0.30
R6943:Glmp UTSW 3 88,233,917 (GRCm39) missense probably damaging 1.00
R6945:Glmp UTSW 3 88,233,139 (GRCm39) missense probably benign 0.02
R7204:Glmp UTSW 3 88,233,917 (GRCm39) missense probably damaging 1.00
R7770:Glmp UTSW 3 88,233,077 (GRCm39) missense probably benign 0.39
R8022:Glmp UTSW 3 88,233,827 (GRCm39) missense probably damaging 1.00
R8079:Glmp UTSW 3 88,233,045 (GRCm39) missense probably damaging 0.98
R8296:Glmp UTSW 3 88,233,580 (GRCm39) missense probably benign 0.16
R8986:Glmp UTSW 3 88,233,002 (GRCm39) missense probably benign 0.28
R9266:Glmp UTSW 3 88,233,036 (GRCm39) missense probably damaging 0.98
R9335:Glmp UTSW 3 88,235,563 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAGCAGCATACAGTTTTCTTCTG -3'
(R):5'- TGAAGGTCAGGCTGCCATTG -3'

Sequencing Primer
(F):5'- CTCGTCTTCACCAGGGTG -3'
(R):5'- CATTGGCGAATGCTCCAGTAG -3'
Posted On 2016-11-21