Mutagenetix > Incidental Mutation

Incidental Mutation 'R5738:Cog2'

444628

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

043350-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124546038 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 525 (T525A)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably benign
Transcript: ENSMUST00000034460
AA Change: T525A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: T525A

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129977

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,621,917	D4826V	probably damaging	Het
Acoxl	G	A	2: 127,877,766	C149Y	probably benign	Het
Adamts3	G	T	5: 89,708,668	H349N	probably damaging	Het
Ap2b1	A	G	11: 83,336,430		probably null	Het
Ap3m2	T	C	8: 22,803,861	S58G	possibly damaging	Het
Bhmt2	A	T	13: 93,663,290	W213R	probably benign	Het
Cacna1h	T	G	17: 25,387,049	D1092A	probably damaging	Het
Cbfb	A	C	8: 105,202,561	Q170P	probably damaging	Het
Ccdc73	A	C	2: 104,930,986	K110N	possibly damaging	Het
Cep350	C	A	1: 155,866,078	R2149L	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fbxl5	A	G	5: 43,762,828	I251T	probably benign	Het
Fscn3	A	G	6: 28,430,031	K67E	possibly damaging	Het
Glmp	T	A	3: 88,326,138	N133K	probably benign	Het
Gpr179	T	C	11: 97,351,406	N204S	probably damaging	Het
Gtf2ird1	C	T	5: 134,383,818	R613Q	probably damaging	Het
Hepacam	A	G	9: 37,383,425	D285G	possibly damaging	Het
Hipk4	G	A	7: 27,528,416	V196M	probably damaging	Het
Hlx	A	T	1: 184,731,557		probably null	Het
Igf2r	A	T	17: 12,717,367	D597E	probably benign	Het
Ighm	T	C	12: 113,421,495	T282A	unknown	Het
Igsf9b	T	C	9: 27,328,530	C624R	probably damaging	Het
Ksr2	T	C	5: 117,748,799	V800A	probably damaging	Het
Lyn	A	T	4: 3,782,987	I386F	probably damaging	Het
Melk	A	G	4: 44,310,333	D102G	probably damaging	Het
Mettl1	G	T	10: 127,041,994	E4*	probably null	Het
Mybl2	C	T	2: 163,068,283	Q210*	probably null	Het
Naga	C	T	15: 82,334,853	W231*	probably null	Het
Olfr131	T	C	17: 38,082,456	Y174C	probably damaging	Het
Olfr730	C	T	14: 50,186,648	V190I	probably benign	Het
Olfr828	T	C	9: 18,815,829	N155S	possibly damaging	Het
Otud4	T	C	8: 79,673,461	S935P	probably benign	Het
P2rx7	C	T	5: 122,652,789	T63I	probably damaging	Het
Pga5	A	T	19: 10,669,660	N260K	probably benign	Het
Phka2	ACC	AC	X: 160,559,866		probably null	Het
Plch1	T	A	3: 63,773,655	R184W	probably damaging	Het
Ppm1b	T	C	17: 84,993,946	F85L	probably benign	Het
Prtg	T	A	9: 72,912,006	F1094I	probably benign	Het
Ralgds	G	A	2: 28,542,526		probably benign	Het
Rgs17	A	C	10: 5,833,140	V149G	probably damaging	Het
Rnf168	A	G	16: 32,282,374	E124G	probably damaging	Het
Sav1	T	C	12: 69,976,043	E245G	possibly damaging	Het
Slc25a19	T	C	11: 115,624,234	I33V	probably benign	Het
Sptbn1	T	C	11: 30,145,941	I318V	probably damaging	Het
Tas2r136	A	G	6: 132,777,744	L140P	probably damaging	Het
Tbc1d9	A	G	8: 83,271,026	I1071V	probably benign	Het
Tecta	G	T	9: 42,373,178	N870K	possibly damaging	Het
Tmem230	G	A	2: 132,244,128	P38L	possibly damaging	Het
Trpa1	G	T	1: 14,875,950	H986N	probably damaging	Het
Wdr41	A	T	13: 94,978,488	I24L	possibly damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CAGTTCTGGTGTCATGGAGAGC -3'
(R):5'- CACTGGAGTCGAGGTGTTAGTC -3'

Sequencing Primer
(F):5'- AGAGCTGTAAAATGAGGTTTTGC -3'
(R):5'- GGTGTTAGTCTAAACATCCCCGAG -3'

Posted On

2016-11-21