Incidental Mutation 'R5738:Olfr828'
ID 444629
Institutional Source Beutler Lab
Gene Symbol Olfr828
Ensembl Gene ENSMUSG00000078116
Gene Name olfactory receptor 828
Synonyms MOR149-1, GA_x6K02T2PVTD-12559294-12558356
MMRRC Submission 043350-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R5738 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 18814728-18819526 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18815829 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 155 (N155S)
Ref Sequence ENSEMBL: ENSMUSP00000148853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104914] [ENSMUST00000213018] [ENSMUST00000215380]
AlphaFold Q8VFM8
Predicted Effect possibly damaging
Transcript: ENSMUST00000104914
AA Change: N155S

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100514
Gene: ENSMUSG00000078116
AA Change: N155S

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213018
AA Change: N155S
Predicted Effect possibly damaging
Transcript: ENSMUST00000215380
AA Change: N155S

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1557 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,621,917 D4826V probably damaging Het
Acoxl G A 2: 127,877,766 C149Y probably benign Het
Adamts3 G T 5: 89,708,668 H349N probably damaging Het
Ap2b1 A G 11: 83,336,430 probably null Het
Ap3m2 T C 8: 22,803,861 S58G possibly damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
Cacna1h T G 17: 25,387,049 D1092A probably damaging Het
Cbfb A C 8: 105,202,561 Q170P probably damaging Het
Ccdc73 A C 2: 104,930,986 K110N possibly damaging Het
Cep350 C A 1: 155,866,078 R2149L probably damaging Het
Cog2 A G 8: 124,546,038 T525A probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fbxl5 A G 5: 43,762,828 I251T probably benign Het
Fscn3 A G 6: 28,430,031 K67E possibly damaging Het
Glmp T A 3: 88,326,138 N133K probably benign Het
Gpr179 T C 11: 97,351,406 N204S probably damaging Het
Gtf2ird1 C T 5: 134,383,818 R613Q probably damaging Het
Hepacam A G 9: 37,383,425 D285G possibly damaging Het
Hipk4 G A 7: 27,528,416 V196M probably damaging Het
Hlx A T 1: 184,731,557 probably null Het
Igf2r A T 17: 12,717,367 D597E probably benign Het
Ighm T C 12: 113,421,495 T282A unknown Het
Igsf9b T C 9: 27,328,530 C624R probably damaging Het
Ksr2 T C 5: 117,748,799 V800A probably damaging Het
Lyn A T 4: 3,782,987 I386F probably damaging Het
Melk A G 4: 44,310,333 D102G probably damaging Het
Mettl1 G T 10: 127,041,994 E4* probably null Het
Mybl2 C T 2: 163,068,283 Q210* probably null Het
Naga C T 15: 82,334,853 W231* probably null Het
Olfr131 T C 17: 38,082,456 Y174C probably damaging Het
Olfr730 C T 14: 50,186,648 V190I probably benign Het
Otud4 T C 8: 79,673,461 S935P probably benign Het
P2rx7 C T 5: 122,652,789 T63I probably damaging Het
Pga5 A T 19: 10,669,660 N260K probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Plch1 T A 3: 63,773,655 R184W probably damaging Het
Ppm1b T C 17: 84,993,946 F85L probably benign Het
Prtg T A 9: 72,912,006 F1094I probably benign Het
Ralgds G A 2: 28,542,526 probably benign Het
Rgs17 A C 10: 5,833,140 V149G probably damaging Het
Rnf168 A G 16: 32,282,374 E124G probably damaging Het
Sav1 T C 12: 69,976,043 E245G possibly damaging Het
Slc25a19 T C 11: 115,624,234 I33V probably benign Het
Sptbn1 T C 11: 30,145,941 I318V probably damaging Het
Tas2r136 A G 6: 132,777,744 L140P probably damaging Het
Tbc1d9 A G 8: 83,271,026 I1071V probably benign Het
Tecta G T 9: 42,373,178 N870K possibly damaging Het
Tmem230 G A 2: 132,244,128 P38L possibly damaging Het
Trpa1 G T 1: 14,875,950 H986N probably damaging Het
Wdr41 A T 13: 94,978,488 I24L possibly damaging Het
Other mutations in Olfr828
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Olfr828 APN 9 18815923 missense probably benign 0.03
IGL02103:Olfr828 APN 9 18815709 missense probably damaging 1.00
IGL02792:Olfr828 APN 9 18815958 missense probably benign 0.00
IGL02964:Olfr828 APN 9 18815728 missense probably damaging 1.00
IGL03087:Olfr828 APN 9 18816084 missense probably damaging 1.00
IGL03105:Olfr828 APN 9 18815389 missense probably benign 0.03
R0330:Olfr828 UTSW 9 18815641 missense probably damaging 1.00
R0335:Olfr828 UTSW 9 18815994 missense probably damaging 1.00
R0862:Olfr828 UTSW 9 18815706 missense probably damaging 0.98
R1226:Olfr828 UTSW 9 18815970 missense probably benign 0.34
R2004:Olfr828 UTSW 9 18815505 missense probably benign 0.05
R2005:Olfr828 UTSW 9 18815505 missense probably benign 0.05
R2006:Olfr828 UTSW 9 18815505 missense probably benign 0.05
R2199:Olfr828 UTSW 9 18815923 missense probably damaging 0.97
R2230:Olfr828 UTSW 9 18815725 missense probably damaging 1.00
R2399:Olfr828 UTSW 9 18816027 missense probably benign 0.07
R5652:Olfr828 UTSW 9 18815626 missense probably damaging 1.00
R6416:Olfr828 UTSW 9 18815892 missense probably benign 0.21
R6813:Olfr828 UTSW 9 18815892 missense probably benign 0.21
R7092:Olfr828 UTSW 9 18816057 missense probably damaging 1.00
R7109:Olfr828 UTSW 9 18815608 missense probably benign 0.01
R7292:Olfr828 UTSW 9 18816190 missense probably damaging 1.00
R7429:Olfr828 UTSW 9 18815354 makesense probably null
R7430:Olfr828 UTSW 9 18815354 makesense probably null
R7490:Olfr828 UTSW 9 18815933 nonsense probably null
R7835:Olfr828 UTSW 9 18815809 missense probably benign 0.05
R8016:Olfr828 UTSW 9 18816292 start codon destroyed probably null 0.56
R8809:Olfr828 UTSW 9 18815623 missense probably damaging 0.99
R8859:Olfr828 UTSW 9 18815696 missense possibly damaging 0.90
R9036:Olfr828 UTSW 9 18816273 missense probably damaging 1.00
R9079:Olfr828 UTSW 9 18815435 missense probably damaging 0.99
R9177:Olfr828 UTSW 9 18815446 missense probably damaging 1.00
R9182:Olfr828 UTSW 9 18815446 missense probably damaging 1.00
R9184:Olfr828 UTSW 9 18815842 missense probably benign 0.10
RF003:Olfr828 UTSW 9 18815482 missense probably benign 0.03
X0026:Olfr828 UTSW 9 18815763 missense possibly damaging 0.95
Z1176:Olfr828 UTSW 9 18815980 frame shift probably null
Z1177:Olfr828 UTSW 9 18816148 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGACATTCTCAAAACAGATGAGGC -3'
(R):5'- ACTAGCTGTCTTACACAAATCTGC -3'

Sequencing Primer
(F):5'- TCTCAAAACAGATGAGGCAATTTGAG -3'
(R):5'- AGCTGTCTTACACAAATCTGCTTTAC -3'
Posted On 2016-11-21