Mutagenetix > Incidental Mutations

Incidental Mutation 'H8786:Klf6'

44463

Institutional Source

Beutler Lab

Gene Symbol

Klf6

Ensembl Gene

ENSMUSG00000000078

Gene Name

Kruppel-like factor 6

Synonyms

BCD1, Copeb, FM6, Zf9, Ierepo3, CPBP, FM2, Ierepo1

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

H8786 (G3) of strain 617

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5861482-5870394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 5861791 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 51 (H51Q)

Ref Sequence

ENSEMBL: ENSMUSP00000000080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000080] [ENSMUST00000222857]

Predicted Effect

probably damaging
Transcript: ENSMUST00000000080
AA Change: H51Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000000080
Gene: ENSMUSG00000000078
AA Change: H51Q

Domain	Start	End	E-Value	Type
low complexity region	107	129	N/A	INTRINSIC
low complexity region	137	155	N/A	INTRINSIC
low complexity region	168	187	N/A	INTRINSIC
ZnF_C2H2	235	259	1.08e-1	SMART
ZnF_C2H2	265	289	1.13e-4	SMART
ZnF_C2H2	295	317	6.32e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186843

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221734

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222857
AA Change: H51Q

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223142

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel-like family of transcription factors. The zinc finger protein is a transcriptional activator, and functions as a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene, some of which are implicated in carcinogenesis. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, small size, pallor, decreased cellular proliferation and delayed liver development. Mice heterozygous for a null allele exhibit delays in embryonic hematopoeisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	A	G	2: 19,494,094	Y363H	probably benign	Het
4933402N03Rik	T	A	7: 131,139,177	R103S	probably damaging	Het
Aars	A	G	8: 111,045,555	D459G	probably benign	Het
Adam25	A	T	8: 40,754,224	M176L	probably benign	Het
Adcy5	A	G	16: 35,267,181	I471V	probably damaging	Het
Ano8	A	T	8: 71,478,744		probably benign	Het
Arhgef28	T	A	13: 97,946,953	Q1136L	probably damaging	Het
Atp13a3	A	T	16: 30,359,725	C164*	probably null	Het
Avl9	G	A	6: 56,757,310	A625T	probably damaging	Het
Avpr1a	A	T	10: 122,449,468	M222L	probably benign	Het
B4galnt4	A	T	7: 141,071,322	M939L	probably damaging	Het
B4galt6	A	G	18: 20,688,944	F331S	probably benign	Het
C2cd2	G	T	16: 97,879,640	Q325K	possibly damaging	Het
Caml	T	G	13: 55,628,596	L216R	probably damaging	Het
Cd200r4	A	G	16: 44,833,373	T132A	possibly damaging	Het
Ces1h	A	C	8: 93,362,922	V283G	probably damaging	Het
Clptm1	A	T	7: 19,635,704	V427D	possibly damaging	Het
Drd1	T	A	13: 54,053,103	N357I	possibly damaging	Het
Foxq1	C	G	13: 31,559,458	S181W	probably damaging	Het
Gfra2	C	T	14: 70,978,378	T169M	possibly damaging	Het
Gm42542	T	C	6: 68,895,650		probably null	Het
Hoxa13	CGG	CGNGG	6: 52,260,636		probably null	Het
Hsd11b1	C	A	1: 193,240,252	A166S	probably benign	Het
Kcnab3	T	A	11: 69,328,267	F101L	probably damaging	Het
Krtap4-8	G	A	11: 99,780,072	P191L	unknown	Het
Lrrk2	T	A	15: 91,673,358	N26K	probably benign	Het
Mrgprd	T	C	7: 145,322,267	S292P	probably benign	Het
Ms4a8a	A	G	19: 11,076,361	I127T	possibly damaging	Het
Myo7a	T	G	7: 98,095,778	N280T	possibly damaging	Het
Nipal4	A	G	11: 46,150,477	F297S	probably damaging	Het
Npas1	A	G	7: 16,461,350	I351T	possibly damaging	Het
Olfr1245	C	A	2: 89,575,279	G149V	probably damaging	Het
Olfr311	A	T	11: 58,841,320	I69F	probably benign	Het
Olfr360	A	G	2: 37,068,329	E8G	probably benign	Het
Parp11	A	G	6: 127,471,635	T72A	probably damaging	Het
Pik3c3	T	C	18: 30,294,343	V300A	probably damaging	Het
Pik3cb	T	C	9: 99,046,559	E881G	possibly damaging	Het
Polr2h	T	A	16: 20,720,531	L57*	probably null	Het
Rela	T	A	19: 5,647,018	S418T	probably benign	Het
Rptn	A	G	3: 93,397,873	T838A	possibly damaging	Het
Sez6l2	T	A	7: 126,961,783	N413K	possibly damaging	Het
Slc6a2	A	G	8: 92,994,640	I466V	probably benign	Het
Slco4c1	A	T	1: 96,841,151	C329S	probably damaging	Het
Sppl2c	A	G	11: 104,186,865	M164V	probably benign	Het
Spta1	G	A	1: 174,179,839	V212M	probably damaging	Het
Sqor	A	C	2: 122,792,368	I142L	probably benign	Het
Suco	T	C	1: 161,852,851	E317G	probably damaging	Het
Tlk2	T	A	11: 105,254,979	I337N	possibly damaging	Het
Tln1	A	T	4: 43,544,589	N1113K	probably damaging	Het
Tmc2	A	G	2: 130,226,262	Y234C	probably damaging	Het
Tmem167	A	C	13: 90,098,466	K36N	probably damaging	Het
Trim72	T	C	7: 128,004,791	L103P	probably damaging	Het
Urb1	T	A	16: 90,769,469	M1477L	probably benign	Het
Vwa2	T	A	19: 56,909,732	M721K	possibly damaging	Het
Zcchc11	T	C	4: 108,550,815		probably null	Het
Zfp143	T	G	7: 110,094,368	D636E	probably damaging	Het

Other mutations in Klf6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Klf6	APN	13	5861681	missense	probably benign	0.02
IGL01714:Klf6	APN	13	5866659	missense	probably benign	0.25
IGL02606:Klf6	APN	13	5866735	missense	probably damaging	1.00
R0689:Klf6	UTSW	13	5865116	missense	probably damaging	1.00
R1174:Klf6	UTSW	13	5861712	missense	probably benign	0.06
R1175:Klf6	UTSW	13	5861712	missense	probably benign	0.06
R4706:Klf6	UTSW	13	5861640	start codon destroyed	probably null	0.66
R4949:Klf6	UTSW	13	5864948	missense	probably benign	0.01
Z1177:Klf6	UTSW	13	5864882	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCATGAAACTTTCACCTGCGCTCC -3'
(R):5'- TTGGTAGTCAAGGCAAGCTCGTTC -3'

Sequencing Primer
(F):5'- CATGGATGTGCTCCCAATGT -3'
(R):5'- TCCGTATTTACCTGTTGCCAA -3'

Posted On

2013-06-11