Incidental Mutation 'R5738:Tecta'
ID 444632
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Name tectorin alpha
Synonyms [a]-tectorin, Tctna
MMRRC Submission 043350-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R5738 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 42240915-42311225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 42284474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 870 (N870K)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
AlphaFold O08523
Predicted Effect possibly damaging
Transcript: ENSMUST00000042190
AA Change: N870K

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: N870K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160940
AA Change: N870K

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: N870K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Meta Mutation Damage Score 0.0658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,571,917 (GRCm39) D4826V probably damaging Het
Acoxl G A 2: 127,719,686 (GRCm39) C149Y probably benign Het
Adamts3 G T 5: 89,856,527 (GRCm39) H349N probably damaging Het
Ap2b1 A G 11: 83,227,256 (GRCm39) probably null Het
Ap3m2 T C 8: 23,293,877 (GRCm39) S58G possibly damaging Het
Bhmt2 A T 13: 93,799,798 (GRCm39) W213R probably benign Het
Cacna1h T G 17: 25,606,023 (GRCm39) D1092A probably damaging Het
Cbfb A C 8: 105,929,193 (GRCm39) Q170P probably damaging Het
Ccdc73 A C 2: 104,761,331 (GRCm39) K110N possibly damaging Het
Cep350 C A 1: 155,741,824 (GRCm39) R2149L probably damaging Het
Cog2 A G 8: 125,272,777 (GRCm39) T525A probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Fbxl5 A G 5: 43,920,170 (GRCm39) I251T probably benign Het
Fscn3 A G 6: 28,430,030 (GRCm39) K67E possibly damaging Het
Glmp T A 3: 88,233,445 (GRCm39) N133K probably benign Het
Gpr179 T C 11: 97,242,232 (GRCm39) N204S probably damaging Het
Gtf2ird1 C T 5: 134,412,672 (GRCm39) R613Q probably damaging Het
Hepacam A G 9: 37,294,721 (GRCm39) D285G possibly damaging Het
Hipk4 G A 7: 27,227,841 (GRCm39) V196M probably damaging Het
Hlx A T 1: 184,463,754 (GRCm39) probably null Het
Igf2r A T 17: 12,936,254 (GRCm39) D597E probably benign Het
Ighm T C 12: 113,385,115 (GRCm39) T282A unknown Het
Igsf9b T C 9: 27,239,826 (GRCm39) C624R probably damaging Het
Ksr2 T C 5: 117,886,864 (GRCm39) V800A probably damaging Het
Lyn A T 4: 3,782,987 (GRCm39) I386F probably damaging Het
Melk A G 4: 44,310,333 (GRCm39) D102G probably damaging Het
Mettl1 G T 10: 126,877,863 (GRCm39) E4* probably null Het
Mybl2 C T 2: 162,910,203 (GRCm39) Q210* probably null Het
Naga C T 15: 82,219,054 (GRCm39) W231* probably null Het
Or2y3 T C 17: 38,393,347 (GRCm39) Y174C probably damaging Het
Or4k2 C T 14: 50,424,105 (GRCm39) V190I probably benign Het
Or7g16 T C 9: 18,727,125 (GRCm39) N155S possibly damaging Het
Otud4 T C 8: 80,400,090 (GRCm39) S935P probably benign Het
P2rx7 C T 5: 122,790,852 (GRCm39) T63I probably damaging Het
Pga5 A T 19: 10,647,024 (GRCm39) N260K probably benign Het
Phka2 ACC AC X: 159,342,862 (GRCm39) probably null Het
Plch1 T A 3: 63,681,076 (GRCm39) R184W probably damaging Het
Ppm1b T C 17: 85,301,374 (GRCm39) F85L probably benign Het
Prtg T A 9: 72,819,288 (GRCm39) F1094I probably benign Het
Ralgds G A 2: 28,432,538 (GRCm39) probably benign Het
Rgs17 A C 10: 5,783,140 (GRCm39) V149G probably damaging Het
Rnf168 A G 16: 32,101,192 (GRCm39) E124G probably damaging Het
Sav1 T C 12: 70,022,817 (GRCm39) E245G possibly damaging Het
Slc25a19 T C 11: 115,515,060 (GRCm39) I33V probably benign Het
Sptbn1 T C 11: 30,095,941 (GRCm39) I318V probably damaging Het
Tas2r136 A G 6: 132,754,707 (GRCm39) L140P probably damaging Het
Tbc1d9 A G 8: 83,997,655 (GRCm39) I1071V probably benign Het
Tmem230 G A 2: 132,086,048 (GRCm39) P38L possibly damaging Het
Trpa1 G T 1: 14,946,174 (GRCm39) H986N probably damaging Het
Wdr41 A T 13: 95,114,996 (GRCm39) I24L possibly damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42,243,844 (GRCm39) missense probably damaging 1.00
IGL00925:Tecta APN 9 42,286,331 (GRCm39) missense probably benign
IGL00960:Tecta APN 9 42,270,376 (GRCm39) missense possibly damaging 0.74
IGL00974:Tecta APN 9 42,242,670 (GRCm39) missense probably benign 0.00
IGL01070:Tecta APN 9 42,306,299 (GRCm39) missense probably damaging 1.00
IGL01284:Tecta APN 9 42,256,916 (GRCm39) missense probably damaging 1.00
IGL01324:Tecta APN 9 42,256,727 (GRCm39) missense probably damaging 1.00
IGL01694:Tecta APN 9 42,278,475 (GRCm39) missense possibly damaging 0.92
IGL01861:Tecta APN 9 42,284,658 (GRCm39) missense probably benign
IGL02010:Tecta APN 9 42,248,489 (GRCm39) missense probably damaging 0.97
IGL02397:Tecta APN 9 42,306,294 (GRCm39) missense probably damaging 1.00
IGL03031:Tecta APN 9 42,256,789 (GRCm39) missense probably benign
IGL03208:Tecta APN 9 42,248,396 (GRCm39) splice site probably benign
IGL03249:Tecta APN 9 42,303,182 (GRCm39) missense probably benign 0.20
cover UTSW 9 42,255,183 (GRCm39) missense probably benign 0.05
lid UTSW 9 42,284,406 (GRCm39) missense probably damaging 0.99
R0004:Tecta UTSW 9 42,256,774 (GRCm39) missense possibly damaging 0.74
R0045:Tecta UTSW 9 42,286,487 (GRCm39) missense probably damaging 1.00
R0045:Tecta UTSW 9 42,286,487 (GRCm39) missense probably damaging 1.00
R0119:Tecta UTSW 9 42,263,359 (GRCm39) missense probably damaging 1.00
R0133:Tecta UTSW 9 42,278,524 (GRCm39) missense probably benign 0.00
R0157:Tecta UTSW 9 42,286,307 (GRCm39) missense probably benign
R0180:Tecta UTSW 9 42,278,109 (GRCm39) missense probably benign
R0299:Tecta UTSW 9 42,263,359 (GRCm39) missense probably damaging 1.00
R0345:Tecta UTSW 9 42,295,514 (GRCm39) missense probably damaging 0.98
R0370:Tecta UTSW 9 42,278,100 (GRCm39) missense probably benign
R0465:Tecta UTSW 9 42,270,714 (GRCm39) missense possibly damaging 0.62
R0466:Tecta UTSW 9 42,284,369 (GRCm39) missense probably benign
R0479:Tecta UTSW 9 42,249,235 (GRCm39) missense probably damaging 1.00
R0498:Tecta UTSW 9 42,288,910 (GRCm39) missense probably damaging 1.00
R0499:Tecta UTSW 9 42,263,359 (GRCm39) missense probably damaging 1.00
R0519:Tecta UTSW 9 42,259,188 (GRCm39) splice site probably benign
R0584:Tecta UTSW 9 42,259,204 (GRCm39) missense possibly damaging 0.79
R0589:Tecta UTSW 9 42,256,930 (GRCm39) missense probably benign 0.01
R0607:Tecta UTSW 9 42,299,501 (GRCm39) missense probably damaging 1.00
R0691:Tecta UTSW 9 42,295,637 (GRCm39) missense probably damaging 1.00
R0905:Tecta UTSW 9 42,250,290 (GRCm39) missense probably damaging 1.00
R1216:Tecta UTSW 9 42,289,203 (GRCm39) missense probably benign 0.44
R1239:Tecta UTSW 9 42,243,781 (GRCm39) missense probably damaging 1.00
R1442:Tecta UTSW 9 42,243,778 (GRCm39) missense probably damaging 1.00
R1553:Tecta UTSW 9 42,259,482 (GRCm39) missense probably damaging 1.00
R1727:Tecta UTSW 9 42,270,597 (GRCm39) missense probably damaging 0.96
R1728:Tecta UTSW 9 42,303,218 (GRCm39) missense probably benign 0.12
R1729:Tecta UTSW 9 42,303,218 (GRCm39) missense probably benign 0.12
R1762:Tecta UTSW 9 42,286,605 (GRCm39) missense probably benign 0.30
R1778:Tecta UTSW 9 42,254,927 (GRCm39) missense probably damaging 1.00
R1795:Tecta UTSW 9 42,289,345 (GRCm39) missense probably benign
R1796:Tecta UTSW 9 42,295,493 (GRCm39) missense probably damaging 1.00
R1866:Tecta UTSW 9 42,303,320 (GRCm39) missense probably damaging 0.97
R1871:Tecta UTSW 9 42,248,636 (GRCm39) missense probably damaging 1.00
R1871:Tecta UTSW 9 42,248,472 (GRCm39) missense probably damaging 0.98
R1911:Tecta UTSW 9 42,249,232 (GRCm39) missense probably damaging 1.00
R2074:Tecta UTSW 9 42,248,575 (GRCm39) nonsense probably null
R2135:Tecta UTSW 9 42,251,581 (GRCm39) missense probably damaging 1.00
R2171:Tecta UTSW 9 42,270,220 (GRCm39) missense probably damaging 0.99
R2220:Tecta UTSW 9 42,303,326 (GRCm39) missense probably damaging 1.00
R2372:Tecta UTSW 9 42,299,570 (GRCm39) missense probably damaging 1.00
R2570:Tecta UTSW 9 42,243,848 (GRCm39) missense probably damaging 1.00
R2939:Tecta UTSW 9 42,289,290 (GRCm39) missense possibly damaging 0.63
R2940:Tecta UTSW 9 42,289,290 (GRCm39) missense possibly damaging 0.63
R3081:Tecta UTSW 9 42,289,290 (GRCm39) missense possibly damaging 0.63
R3407:Tecta UTSW 9 42,249,150 (GRCm39) missense probably damaging 1.00
R3732:Tecta UTSW 9 42,303,402 (GRCm39) missense possibly damaging 0.95
R3771:Tecta UTSW 9 42,242,292 (GRCm39) missense probably damaging 1.00
R3772:Tecta UTSW 9 42,242,292 (GRCm39) missense probably damaging 1.00
R3773:Tecta UTSW 9 42,242,292 (GRCm39) missense probably damaging 1.00
R3832:Tecta UTSW 9 42,250,329 (GRCm39) missense probably damaging 1.00
R4378:Tecta UTSW 9 42,278,004 (GRCm39) missense probably damaging 1.00
R4480:Tecta UTSW 9 42,284,529 (GRCm39) missense possibly damaging 0.75
R4485:Tecta UTSW 9 42,248,570 (GRCm39) missense possibly damaging 0.73
R4804:Tecta UTSW 9 42,309,533 (GRCm39) missense probably benign
R4869:Tecta UTSW 9 42,286,830 (GRCm39) missense probably benign 0.02
R4944:Tecta UTSW 9 42,241,573 (GRCm39) missense probably benign 0.05
R5008:Tecta UTSW 9 42,284,358 (GRCm39) missense possibly damaging 0.76
R5014:Tecta UTSW 9 42,284,538 (GRCm39) missense probably damaging 1.00
R5125:Tecta UTSW 9 42,286,481 (GRCm39) missense probably damaging 1.00
R5178:Tecta UTSW 9 42,286,481 (GRCm39) missense probably damaging 1.00
R5180:Tecta UTSW 9 42,248,504 (GRCm39) missense probably damaging 1.00
R5214:Tecta UTSW 9 42,256,964 (GRCm39) missense probably benign 0.04
R5230:Tecta UTSW 9 42,306,239 (GRCm39) missense probably damaging 0.96
R5330:Tecta UTSW 9 42,249,152 (GRCm39) missense probably damaging 1.00
R5387:Tecta UTSW 9 42,286,359 (GRCm39) missense probably damaging 0.98
R5614:Tecta UTSW 9 42,250,351 (GRCm39) missense probably damaging 1.00
R5708:Tecta UTSW 9 42,250,222 (GRCm39) missense probably damaging 1.00
R5770:Tecta UTSW 9 42,256,885 (GRCm39) missense possibly damaging 0.94
R5839:Tecta UTSW 9 42,284,272 (GRCm39) missense possibly damaging 0.86
R5839:Tecta UTSW 9 42,242,319 (GRCm39) missense probably benign 0.03
R6119:Tecta UTSW 9 42,284,371 (GRCm39) missense probably benign 0.00
R6246:Tecta UTSW 9 42,289,204 (GRCm39) missense probably benign 0.07
R6377:Tecta UTSW 9 42,255,051 (GRCm39) missense probably damaging 1.00
R6416:Tecta UTSW 9 42,286,563 (GRCm39) missense probably damaging 0.97
R6595:Tecta UTSW 9 42,295,523 (GRCm39) missense probably damaging 1.00
R6850:Tecta UTSW 9 42,255,134 (GRCm39) missense probably benign 0.20
R6859:Tecta UTSW 9 42,303,425 (GRCm39) missense probably damaging 1.00
R6861:Tecta UTSW 9 42,248,633 (GRCm39) missense possibly damaging 0.93
R6939:Tecta UTSW 9 42,259,293 (GRCm39) missense probably damaging 1.00
R6996:Tecta UTSW 9 42,278,082 (GRCm39) missense probably benign
R7069:Tecta UTSW 9 42,306,237 (GRCm39) missense probably benign 0.03
R7104:Tecta UTSW 9 42,278,239 (GRCm39) missense probably benign 0.00
R7129:Tecta UTSW 9 42,259,287 (GRCm39) missense probably damaging 1.00
R7220:Tecta UTSW 9 42,255,183 (GRCm39) missense probably benign 0.05
R7251:Tecta UTSW 9 42,299,048 (GRCm39) missense probably damaging 1.00
R7307:Tecta UTSW 9 42,289,288 (GRCm39) missense probably damaging 1.00
R7343:Tecta UTSW 9 42,248,628 (GRCm39) missense probably damaging 1.00
R7355:Tecta UTSW 9 42,278,438 (GRCm39) nonsense probably null
R7635:Tecta UTSW 9 42,242,283 (GRCm39) missense probably benign 0.11
R7653:Tecta UTSW 9 42,248,532 (GRCm39) missense probably damaging 1.00
R7723:Tecta UTSW 9 42,278,232 (GRCm39) missense probably damaging 1.00
R7939:Tecta UTSW 9 42,299,519 (GRCm39) missense probably damaging 0.99
R7966:Tecta UTSW 9 42,306,258 (GRCm39) missense probably damaging 0.98
R7967:Tecta UTSW 9 42,289,251 (GRCm39) missense possibly damaging 0.95
R8000:Tecta UTSW 9 42,278,480 (GRCm39) nonsense probably null
R8064:Tecta UTSW 9 42,306,251 (GRCm39) missense possibly damaging 0.94
R8117:Tecta UTSW 9 42,288,927 (GRCm39) missense probably damaging 1.00
R8176:Tecta UTSW 9 42,270,465 (GRCm39) missense probably damaging 0.97
R8284:Tecta UTSW 9 42,289,325 (GRCm39) missense possibly damaging 0.89
R8315:Tecta UTSW 9 42,299,121 (GRCm39) critical splice acceptor site probably null
R8321:Tecta UTSW 9 42,284,349 (GRCm39) missense probably damaging 1.00
R8332:Tecta UTSW 9 42,286,310 (GRCm39) missense probably damaging 1.00
R8437:Tecta UTSW 9 42,243,856 (GRCm39) missense probably damaging 0.98
R8496:Tecta UTSW 9 42,241,547 (GRCm39) missense probably benign 0.01
R8514:Tecta UTSW 9 42,284,406 (GRCm39) missense probably damaging 0.99
R8683:Tecta UTSW 9 42,278,268 (GRCm39) missense probably damaging 0.96
R8856:Tecta UTSW 9 42,284,597 (GRCm39) missense probably benign 0.13
R8886:Tecta UTSW 9 42,278,359 (GRCm39) missense probably benign 0.37
R9047:Tecta UTSW 9 42,286,375 (GRCm39) missense probably benign 0.00
R9106:Tecta UTSW 9 42,278,479 (GRCm39) missense probably benign 0.05
R9332:Tecta UTSW 9 42,284,193 (GRCm39) missense probably damaging 1.00
R9352:Tecta UTSW 9 42,249,147 (GRCm39) missense probably damaging 1.00
R9462:Tecta UTSW 9 42,248,576 (GRCm39) missense probably damaging 1.00
R9535:Tecta UTSW 9 42,270,759 (GRCm39) missense probably damaging 0.99
R9564:Tecta UTSW 9 42,249,123 (GRCm39) missense probably damaging 0.97
R9592:Tecta UTSW 9 42,250,238 (GRCm39) missense probably damaging 1.00
R9715:Tecta UTSW 9 42,286,596 (GRCm39) missense probably damaging 1.00
Z1176:Tecta UTSW 9 42,303,390 (GRCm39) missense probably damaging 0.99
Z1177:Tecta UTSW 9 42,286,872 (GRCm39) missense probably benign 0.00
Z1177:Tecta UTSW 9 42,303,366 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCTCTGACTCATTGCC -3'
(R):5'- GCACAACTGTGGAGTCCAAG -3'

Sequencing Primer
(F):5'- TAGTAGGCGGTGACATTAACCACC -3'
(R):5'- AACTGTGGAGTCCAAGGGTGTG -3'
Posted On 2016-11-21