Incidental Mutation 'R5738:Ap2b1'
ID 444637
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Name adaptor-related protein complex 2, beta 1 subunit
Synonyms 1300012O03Rik
MMRRC Submission 043350-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5738 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 83299024-83405035 bp(+) (GRCm38)
Type of Mutation splice site (3372 bp from exon)
DNA Base Change (assembly) A to G at 83336430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]
AlphaFold Q9DBG3
Predicted Effect probably benign
Transcript: ENSMUST00000018875
AA Change: I343V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: I343V

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065692
AA Change: I343V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: I343V

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132178
Predicted Effect probably benign
Transcript: ENSMUST00000176430
AA Change: I343V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: I343V

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176523
AA Change: I305V

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: I305V

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176944
SMART Domains Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 199 3.4e-67 PFAM
Pfam:DNA_alkylation 18 196 4.6e-8 PFAM
Pfam:HEAT_2 88 185 3.1e-13 PFAM
Pfam:Cnd1 99 198 4.2e-27 PFAM
Pfam:HEAT 122 151 1.4e-5 PFAM
Meta Mutation Damage Score 0.2748 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,621,917 D4826V probably damaging Het
Acoxl G A 2: 127,877,766 C149Y probably benign Het
Adamts3 G T 5: 89,708,668 H349N probably damaging Het
Ap3m2 T C 8: 22,803,861 S58G possibly damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
Cacna1h T G 17: 25,387,049 D1092A probably damaging Het
Cbfb A C 8: 105,202,561 Q170P probably damaging Het
Ccdc73 A C 2: 104,930,986 K110N possibly damaging Het
Cep350 C A 1: 155,866,078 R2149L probably damaging Het
Cog2 A G 8: 124,546,038 T525A probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fbxl5 A G 5: 43,762,828 I251T probably benign Het
Fscn3 A G 6: 28,430,031 K67E possibly damaging Het
Glmp T A 3: 88,326,138 N133K probably benign Het
Gpr179 T C 11: 97,351,406 N204S probably damaging Het
Gtf2ird1 C T 5: 134,383,818 R613Q probably damaging Het
Hepacam A G 9: 37,383,425 D285G possibly damaging Het
Hipk4 G A 7: 27,528,416 V196M probably damaging Het
Hlx A T 1: 184,731,557 probably null Het
Igf2r A T 17: 12,717,367 D597E probably benign Het
Ighm T C 12: 113,421,495 T282A unknown Het
Igsf9b T C 9: 27,328,530 C624R probably damaging Het
Ksr2 T C 5: 117,748,799 V800A probably damaging Het
Lyn A T 4: 3,782,987 I386F probably damaging Het
Melk A G 4: 44,310,333 D102G probably damaging Het
Mettl1 G T 10: 127,041,994 E4* probably null Het
Mybl2 C T 2: 163,068,283 Q210* probably null Het
Naga C T 15: 82,334,853 W231* probably null Het
Olfr131 T C 17: 38,082,456 Y174C probably damaging Het
Olfr730 C T 14: 50,186,648 V190I probably benign Het
Olfr828 T C 9: 18,815,829 N155S possibly damaging Het
Otud4 T C 8: 79,673,461 S935P probably benign Het
P2rx7 C T 5: 122,652,789 T63I probably damaging Het
Pga5 A T 19: 10,669,660 N260K probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Plch1 T A 3: 63,773,655 R184W probably damaging Het
Ppm1b T C 17: 84,993,946 F85L probably benign Het
Prtg T A 9: 72,912,006 F1094I probably benign Het
Ralgds G A 2: 28,542,526 probably benign Het
Rgs17 A C 10: 5,833,140 V149G probably damaging Het
Rnf168 A G 16: 32,282,374 E124G probably damaging Het
Sav1 T C 12: 69,976,043 E245G possibly damaging Het
Slc25a19 T C 11: 115,624,234 I33V probably benign Het
Sptbn1 T C 11: 30,145,941 I318V probably damaging Het
Tas2r136 A G 6: 132,777,744 L140P probably damaging Het
Tbc1d9 A G 8: 83,271,026 I1071V probably benign Het
Tecta G T 9: 42,373,178 N870K possibly damaging Het
Tmem230 G A 2: 132,244,128 P38L possibly damaging Het
Trpa1 G T 1: 14,875,950 H986N probably damaging Het
Wdr41 A T 13: 94,978,488 I24L possibly damaging Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83333158 missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83324611 missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83321973 missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83335530 missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83346766 missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83336799 missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83341384 missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83368026 missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83321967 missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83367874 splice site probably benign
R1222:Ap2b1 UTSW 11 83346738 missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83333109 missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83346831 missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83324604 missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83390735 missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83390735 missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83346895 missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83336386 missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83351118 missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83324761 splice site probably benign
R3615:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83324565 missense possibly damaging 0.84
R3983:Ap2b1 UTSW 11 83390716 missense probably damaging 1.00
R4124:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83365645 critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83342603 missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83335604 critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83324650 missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83397779 missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83333011 nonsense probably null
R4916:Ap2b1 UTSW 11 83390706 missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83339392 missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83342601 missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83336737 splice site probably null
R6023:Ap2b1 UTSW 11 83335398 missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83346673 missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83346825 missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83308239 start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83342679 missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83335491 missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83389726 missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83333122 missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83351105 missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83367998 missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83324522 missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83389728 missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83339430 critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83367907 nonsense probably null
R8468:Ap2b1 UTSW 11 83351065 missense probably damaging 1.00
R8943:Ap2b1 UTSW 11 83346753 missense probably damaging 1.00
R9093:Ap2b1 UTSW 11 83324569 missense probably damaging 1.00
R9621:Ap2b1 UTSW 11 83402598 missense probably damaging 1.00
X0064:Ap2b1 UTSW 11 83324569 missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83365753 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGACTTGATTTTCATACAGGCC -3'
(R):5'- GGCATATTCCTTCAGCTCCG -3'

Sequencing Primer
(F):5'- CTTGATTTTCATACAGGCCAAGGAGG -3'
(R):5'- ACACTGTAGCTGTCTTCAGATG -3'
Posted On 2016-11-21