Mutagenetix > Incidental Mutation

Incidental Mutation 'R5738:Ap2b1'

444637

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

043350-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5738 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

splice site (3372 bp from exon)

DNA Base Change (assembly)

A to G at 83336430 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523] [ENSMUST00000176944]

AlphaFold

Q9DBG3

Predicted Effect

probably benign
Transcript: ENSMUST00000018875
AA Change: I343V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: I343V

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065692
AA Change: I343V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: I343V

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

probably benign
Transcript: ENSMUST00000176430
AA Change: I343V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: I343V

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176523
AA Change: I305V

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: I305V

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000176944

SMART Domains

Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	199	3.4e-67	PFAM
Pfam:DNA_alkylation	18	196	4.6e-8	PFAM
Pfam:HEAT_2	88	185	3.1e-13	PFAM
Pfam:Cnd1	99	198	4.2e-27	PFAM
Pfam:HEAT	122	151	1.4e-5	PFAM

Meta Mutation Damage Score

0.2748

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

98% (52/53)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,621,917	D4826V	probably damaging	Het
Acoxl	G	A	2: 127,877,766	C149Y	probably benign	Het
Adamts3	G	T	5: 89,708,668	H349N	probably damaging	Het
Ap3m2	T	C	8: 22,803,861	S58G	possibly damaging	Het
Bhmt2	A	T	13: 93,663,290	W213R	probably benign	Het
Cacna1h	T	G	17: 25,387,049	D1092A	probably damaging	Het
Cbfb	A	C	8: 105,202,561	Q170P	probably damaging	Het
Ccdc73	A	C	2: 104,930,986	K110N	possibly damaging	Het
Cep350	C	A	1: 155,866,078	R2149L	probably damaging	Het
Cog2	A	G	8: 124,546,038	T525A	probably benign	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Fbxl5	A	G	5: 43,762,828	I251T	probably benign	Het
Fscn3	A	G	6: 28,430,031	K67E	possibly damaging	Het
Glmp	T	A	3: 88,326,138	N133K	probably benign	Het
Gpr179	T	C	11: 97,351,406	N204S	probably damaging	Het
Gtf2ird1	C	T	5: 134,383,818	R613Q	probably damaging	Het
Hepacam	A	G	9: 37,383,425	D285G	possibly damaging	Het
Hipk4	G	A	7: 27,528,416	V196M	probably damaging	Het
Hlx	A	T	1: 184,731,557		probably null	Het
Igf2r	A	T	17: 12,717,367	D597E	probably benign	Het
Ighm	T	C	12: 113,421,495	T282A	unknown	Het
Igsf9b	T	C	9: 27,328,530	C624R	probably damaging	Het
Ksr2	T	C	5: 117,748,799	V800A	probably damaging	Het
Lyn	A	T	4: 3,782,987	I386F	probably damaging	Het
Melk	A	G	4: 44,310,333	D102G	probably damaging	Het
Mettl1	G	T	10: 127,041,994	E4*	probably null	Het
Mybl2	C	T	2: 163,068,283	Q210*	probably null	Het
Naga	C	T	15: 82,334,853	W231*	probably null	Het
Olfr131	T	C	17: 38,082,456	Y174C	probably damaging	Het
Olfr730	C	T	14: 50,186,648	V190I	probably benign	Het
Olfr828	T	C	9: 18,815,829	N155S	possibly damaging	Het
Otud4	T	C	8: 79,673,461	S935P	probably benign	Het
P2rx7	C	T	5: 122,652,789	T63I	probably damaging	Het
Pga5	A	T	19: 10,669,660	N260K	probably benign	Het
Phka2	ACC	AC	X: 160,559,866		probably null	Het
Plch1	T	A	3: 63,773,655	R184W	probably damaging	Het
Ppm1b	T	C	17: 84,993,946	F85L	probably benign	Het
Prtg	T	A	9: 72,912,006	F1094I	probably benign	Het
Ralgds	G	A	2: 28,542,526		probably benign	Het
Rgs17	A	C	10: 5,833,140	V149G	probably damaging	Het
Rnf168	A	G	16: 32,282,374	E124G	probably damaging	Het
Sav1	T	C	12: 69,976,043	E245G	possibly damaging	Het
Slc25a19	T	C	11: 115,624,234	I33V	probably benign	Het
Sptbn1	T	C	11: 30,145,941	I318V	probably damaging	Het
Tas2r136	A	G	6: 132,777,744	L140P	probably damaging	Het
Tbc1d9	A	G	8: 83,271,026	I1071V	probably benign	Het
Tecta	G	T	9: 42,373,178	N870K	possibly damaging	Het
Tmem230	G	A	2: 132,244,128	P38L	possibly damaging	Het
Trpa1	G	T	1: 14,875,950	H986N	probably damaging	Het
Wdr41	A	T	13: 94,978,488	I24L	possibly damaging	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGACTTGATTTTCATACAGGCC -3'
(R):5'- GGCATATTCCTTCAGCTCCG -3'

Sequencing Primer
(F):5'- CTTGATTTTCATACAGGCCAAGGAGG -3'
(R):5'- ACACTGTAGCTGTCTTCAGATG -3'

Posted On

2016-11-21