Incidental Mutation 'R5738:Ighm'
ID444641
Institutional Source Beutler Lab
Gene Symbol Ighm
Ensembl Gene ENSMUSG00000076617
Gene Nameimmunoglobulin heavy constant mu
SynonymsmuH, IgM, Igh6, Igh-M, Ig mu
MMRRC Submission 043350-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5738 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113418558-113422730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113421495 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 282 (T282A)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000103426
AA Change: T282A
SMART Domains Protein: ENSMUSP00000100222
Gene: ENSMUSG00000076617
AA Change: T282A

DomainStartEndE-ValueType
IG_like 23 99 1.94e-2 SMART
IGc1 131 209 2.37e-14 SMART
IG_like 241 315 1.6e-2 SMART
IGc1 348 425 1.94e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175007
Predicted Effect unknown
Transcript: ENSMUST00000177715
AA Change: T282A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196624
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (52/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,621,917 D4826V probably damaging Het
Acoxl G A 2: 127,877,766 C149Y probably benign Het
Adamts3 G T 5: 89,708,668 H349N probably damaging Het
Ap2b1 A G 11: 83,336,430 probably null Het
Ap3m2 T C 8: 22,803,861 S58G possibly damaging Het
Bhmt2 A T 13: 93,663,290 W213R probably benign Het
Cacna1h T G 17: 25,387,049 D1092A probably damaging Het
Cbfb A C 8: 105,202,561 Q170P probably damaging Het
Ccdc73 A C 2: 104,930,986 K110N possibly damaging Het
Cep350 C A 1: 155,866,078 R2149L probably damaging Het
Cog2 A G 8: 124,546,038 T525A probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Fbxl5 A G 5: 43,762,828 I251T probably benign Het
Fscn3 A G 6: 28,430,031 K67E possibly damaging Het
Glmp T A 3: 88,326,138 N133K probably benign Het
Gpr179 T C 11: 97,351,406 N204S probably damaging Het
Gtf2ird1 C T 5: 134,383,818 R613Q probably damaging Het
Hepacam A G 9: 37,383,425 D285G possibly damaging Het
Hipk4 G A 7: 27,528,416 V196M probably damaging Het
Hlx A T 1: 184,731,557 probably null Het
Igf2r A T 17: 12,717,367 D597E probably benign Het
Igsf9b T C 9: 27,328,530 C624R probably damaging Het
Ksr2 T C 5: 117,748,799 V800A probably damaging Het
Lyn A T 4: 3,782,987 I386F probably damaging Het
Melk A G 4: 44,310,333 D102G probably damaging Het
Mettl1 G T 10: 127,041,994 E4* probably null Het
Mybl2 C T 2: 163,068,283 Q210* probably null Het
Naga C T 15: 82,334,853 W231* probably null Het
Olfr131 T C 17: 38,082,456 Y174C probably damaging Het
Olfr730 C T 14: 50,186,648 V190I probably benign Het
Olfr828 T C 9: 18,815,829 N155S possibly damaging Het
Otud4 T C 8: 79,673,461 S935P probably benign Het
P2rx7 C T 5: 122,652,789 T63I probably damaging Het
Pga5 A T 19: 10,669,660 N260K probably benign Het
Phka2 ACC AC X: 160,559,866 probably null Het
Plch1 T A 3: 63,773,655 R184W probably damaging Het
Ppm1b T C 17: 84,993,946 F85L probably benign Het
Prtg T A 9: 72,912,006 F1094I probably benign Het
Ralgds G A 2: 28,542,526 probably benign Het
Rgs17 A C 10: 5,833,140 V149G probably damaging Het
Rnf168 A G 16: 32,282,374 E124G probably damaging Het
Sav1 T C 12: 69,976,043 E245G possibly damaging Het
Slc25a19 T C 11: 115,624,234 I33V probably benign Het
Sptbn1 T C 11: 30,145,941 I318V probably damaging Het
Tas2r136 A G 6: 132,777,744 L140P probably damaging Het
Tbc1d9 A G 8: 83,271,026 I1071V probably benign Het
Tecta G T 9: 42,373,178 N870K possibly damaging Het
Tmem230 G A 2: 132,244,128 P38L possibly damaging Het
Trpa1 G T 1: 14,875,950 H986N probably damaging Het
Wdr41 A T 13: 94,978,488 I24L possibly damaging Het
Other mutations in Ighm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Ighm APN 12 113421234 unclassified probably benign
IGL01775:Ighm APN 12 113422467 missense unknown
IGL02069:Ighm APN 12 113421148 unclassified probably benign
IGL03124:Ighm APN 12 113421638 missense unknown
manifest UTSW 12 113421253 nonsense probably null
R3055:Ighm UTSW 12 113418976 unclassified probably benign
R3056:Ighm UTSW 12 113418976 unclassified probably benign
R4164:Ighm UTSW 12 113422295 missense unknown
R4475:Ighm UTSW 12 113420893 unclassified probably benign
R4871:Ighm UTSW 12 113421621 missense unknown
R5542:Ighm UTSW 12 113418981 unclassified probably benign
R5856:Ighm UTSW 12 113421602 missense unknown
R5946:Ighm UTSW 12 113422709 missense unknown
R6267:Ighm UTSW 12 113421567 missense unknown
R6296:Ighm UTSW 12 113421567 missense unknown
R7409:Ighm UTSW 12 113422232 missense
R7492:Ighm UTSW 12 113422673 missense
R7898:Ighm UTSW 12 113421253 nonsense probably null
R8089:Ighm UTSW 12 113421234 unclassified probably benign
R8301:Ighm UTSW 12 113421545 missense
R8444:Ighm UTSW 12 113421193 missense
Predicted Primers PCR Primer
(F):5'- CTATGAGGTACAGGAAGGGTCC -3'
(R):5'- TGACACAGTGTTCTCTTGACTG -3'

Sequencing Primer
(F):5'- GGAAGGGTCCTGCAATTGG -3'
(R):5'- ACAGTGTTCTCTTGACTGCAGGTC -3'
Posted On2016-11-21