Mutagenetix > Incidental Mutations

Incidental Mutation 'R5739:Armc3'

444660

Institutional Source

Beutler Lab

Gene Symbol

Armc3

Ensembl Gene

ENSMUSG00000037683

Gene Name

armadillo repeat containing 3

Synonyms

4921513G22Rik

MMRRC Submission

043351-MU

Accession Numbers

Ncbi RefSeq: NM_001081083.2, NM_001271563.1, NM_001271564.1, NM_001271565.1; MGI:1918132

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R5739 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19199302-19310241 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19253917 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 265 (D265G)

Ref Sequence

ENSEMBL: ENSMUSP00000048784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049255] [ENSMUST00000114640]

AlphaFold

A2AU72

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049255
AA Change: D265G

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000048784
Gene: ENSMUSG00000037683
AA Change: D265G

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
low complexity region	544	557	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	620	639	N/A	INTRINSIC
low complexity region	675	696	N/A	INTRINSIC
Pfam:EDR1	723	857	3.1e-28	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114640
AA Change: D265G

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000110287
Gene: ENSMUSG00000037683
AA Change: D265G

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
ARM	56	96	2.07e-2	SMART
ARM	97	138	9.84e1	SMART
ARM	139	179	7.86e-3	SMART
ARM	180	220	7.63e0	SMART
ARM	221	262	7.76e1	SMART
low complexity region	293	303	N/A	INTRINSIC
ARM	305	345	3.91e1	SMART
ARM	346	385	2.93e-2	SMART
ARM	387	427	7.74e-2	SMART
Blast:ARM	428	468	3e-11	BLAST
ARM	469	509	1.45e-1	SMART
Pfam:EDR1	549	868	1.4e-41	PFAM

Meta Mutation Damage Score

0.1282

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934]).[supplied by OMIM, Mar 2008]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	A	T	9: 94,520,541	V356E	possibly damaging	Het
4931429L15Rik	A	T	9: 46,309,419	S50T	probably benign	Het
A930011G23Rik	A	G	5: 99,221,430	L529P	probably damaging	Het
Acer2	A	T	4: 86,900,555	N147Y	probably damaging	Het
Adamtsl1	A	G	4: 86,232,664	E353G	probably damaging	Het
Alg6	T	C	4: 99,744,500	F60L	probably benign	Het
Ano6	A	T	15: 95,913,379	D120V	probably damaging	Het
Arntl	G	A	7: 113,285,031	R92Q	probably damaging	Het
Aurkc	A	T	7: 7,002,860	Y249F	probably benign	Het
Cacna2d2	A	G	9: 107,512,329	I274V	probably benign	Het
Camk2n2	C	A	16: 20,621,080	G39C	probably damaging	Het
Ccdc39	A	G	3: 33,826,561	L419P	possibly damaging	Het
Cdh23	T	C	10: 60,305,609	M3117V	probably damaging	Het
Celsr3	A	G	9: 108,827,158	E280G	probably benign	Het
Cherp	TGCTGGTGGTGGGG	TG	8: 72,467,815		probably benign	Het
Clcn6	A	G	4: 148,014,189	V494A	probably damaging	Het
Col19a1	C	T	1: 24,337,915	G450S	probably damaging	Het
Crb2	T	G	2: 37,793,654	V1056G	probably damaging	Het
Crtac1	A	G	19: 42,302,173	F363S	probably damaging	Het
Dnaaf2	T	C	12: 69,196,941	S449G	probably benign	Het
Dnah7b	A	T	1: 46,233,992	I2427F	probably damaging	Het
Dnah8	T	A	17: 30,719,007	D1619E	probably benign	Het
Dock3	A	T	9: 106,973,796	S836T	possibly damaging	Het
Donson	A	T	16: 91,681,229		probably null	Het
Drc3	G	A	11: 60,375,130	R215H	possibly damaging	Het
Entpd2	T	C	2: 25,399,492	S329P	possibly damaging	Het
Eya2	T	C	2: 165,761,937	S332P	probably damaging	Het
Fam83f	T	A	15: 80,692,005	Y286N	probably damaging	Het
Fat4	T	C	3: 38,983,134	V3645A	probably benign	Het
G2e3	T	C	12: 51,372,504	F668L	possibly damaging	Het
Gm14403	T	A	2: 177,509,247	C329S	probably damaging	Het
Hmcn1	G	A	1: 150,808,697	T374I	probably benign	Het
Hmcn1	A	T	1: 150,758,474		probably null	Het
Hrnr	T	C	3: 93,323,129	S225P	unknown	Het
Ifi202b	C	T	1: 173,971,352		probably null	Het
Il10ra	A	T	9: 45,256,070	D394E	possibly damaging	Het
Itga2b	A	T	11: 102,465,909	D275E	probably benign	Het
Jaml	A	T	9: 45,088,728	D108V	probably damaging	Het
Kir3dl1	G	A	X: 136,526,482	D56N	probably damaging	Het
Lrrtm1	T	C	6: 77,244,889	V443A	probably damaging	Het
Mkln1	T	A	6: 31,496,702	S126R	probably benign	Het
Myo19	T	C	11: 84,897,624	I354T	probably damaging	Het
Nucb1	A	T	7: 45,501,660	L99Q	probably damaging	Het
Olfr1312	A	G	2: 112,042,783	F83S	probably damaging	Het
Pask	A	G	1: 93,322,056	S541P	probably benign	Het
Pdpr	A	T	8: 111,134,620	I749F	possibly damaging	Het
Phyhipl	T	C	10: 70,559,569	D269G	possibly damaging	Het
Pkdcc	A	G	17: 83,215,794	D110G	probably benign	Het
Ppox	A	G	1: 171,279,996	L115P	probably damaging	Het
Ppp1r12c	A	G	7: 4,497,282	L94P	probably damaging	Het
Ppp6r2	T	A	15: 89,259,073	M141K	probably benign	Het
Prl3d1	A	T	13: 27,100,012	H188L	probably benign	Het
Psmb3	T	A	11: 97,713,470		probably benign	Het
Pxdn	T	A	12: 29,982,334	S150T	probably benign	Het
Ripor3	T	C	2: 167,981,283	T903A	probably damaging	Het
Rnase4	T	C	14: 51,104,849	L10S	probably benign	Het
Rnf224	T	C	2: 25,236,000	T114A	probably benign	Het
Rp1l1	A	T	14: 64,032,170	E1735V	probably benign	Het
Rrp1b	T	A	17: 32,045,976	Y60N	probably damaging	Het
Rsbn1l	A	T	5: 20,905,816	V508E	probably damaging	Het
Rubcnl	T	C	14: 75,040,941		probably null	Het
Rxfp4	A	G	3: 88,651,902		probably benign	Het
Sdccag8	A	G	1: 176,826,231	T85A	probably benign	Het
Slc46a1	A	T	11: 78,467,149	I343F	possibly damaging	Het
Ssh2	A	G	11: 77,449,813	D597G	probably damaging	Het
Syne2	T	A	12: 75,997,465	V3942E	possibly damaging	Het
Timd4	T	C	11: 46,817,746	S200P	probably benign	Het
Tmc5	G	A	7: 118,666,611		probably null	Het
Tmem8	T	A	17: 26,120,451	F580I	probably damaging	Het
Trbv16	A	G	6: 41,152,079	T66A	probably benign	Het
Ttc3	A	T	16: 94,439,324	K1103*	probably null	Het
Ttc7b	A	G	12: 100,384,233	V458A	probably damaging	Het
Ubxn10	A	G	4: 138,720,823	S181P	probably benign	Het
Vmn2r11	A	G	5: 109,059,248		probably null	Het
Vmn2r26	A	T	6: 124,025,966	N112Y	probably benign	Het
Vmn2r5	T	C	3: 64,504,076	D357G	probably damaging	Het
Zc3h10	T	C	10: 128,544,801	N229S	probably benign	Het
Zfp407	T	C	18: 84,208,742	*2247W	probably null	Het
Zfyve1	C	A	12: 83,575,136	V162L	possibly damaging	Het

Other mutations in Armc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Armc3	APN	2	19303858	missense	possibly damaging	0.48
IGL01123:Armc3	APN	2	19201805	missense	possibly damaging	0.87
IGL01142:Armc3	APN	2	19297898	splice site	probably benign
IGL01556:Armc3	APN	2	19269146	missense	probably damaging	1.00
IGL02145:Armc3	APN	2	19296860	missense	possibly damaging	0.81
IGL02145:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02152:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02154:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02243:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02244:Armc3	APN	2	19286137	critical splice donor site	probably null
IGL02516:Armc3	APN	2	19300506	missense	possibly damaging	0.94
IGL02691:Armc3	APN	2	19235484	missense	probably damaging	1.00
IGL03151:Armc3	APN	2	19238698	missense	probably damaging	1.00
IGL03190:Armc3	APN	2	19288950	missense	probably damaging	0.99
IGL03288:Armc3	APN	2	19235482	missense	probably damaging	1.00
IGL03338:Armc3	APN	2	19248701	missense	possibly damaging	0.88
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0015:Armc3	UTSW	2	19296321	critical splice acceptor site	probably null
R0256:Armc3	UTSW	2	19269216	missense	probably damaging	1.00
R0621:Armc3	UTSW	2	19295393	missense	probably damaging	0.96
R1326:Armc3	UTSW	2	19310124	makesense	probably null
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1470:Armc3	UTSW	2	19238736	missense	probably benign
R1489:Armc3	UTSW	2	19310047	missense	probably benign	0.01
R1990:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1991:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R1992:Armc3	UTSW	2	19293142	missense	probably damaging	0.97
R2002:Armc3	UTSW	2	19288936	missense	probably benign	0.01
R2095:Armc3	UTSW	2	19288929	missense	possibly damaging	0.65
R2127:Armc3	UTSW	2	19201811	missense	probably damaging	1.00
R2158:Armc3	UTSW	2	19248633	missense	probably damaging	0.99
R2697:Armc3	UTSW	2	19303935	missense	probably damaging	1.00
R3809:Armc3	UTSW	2	19300665	missense	probably damaging	1.00
R3897:Armc3	UTSW	2	19269177	missense	probably damaging	1.00
R4107:Armc3	UTSW	2	19288909	missense	probably benign	0.13
R4326:Armc3	UTSW	2	19300473	missense	probably damaging	0.97
R4464:Armc3	UTSW	2	19248659	missense	probably damaging	0.99
R4702:Armc3	UTSW	2	19309981	missense	probably damaging	1.00
R4923:Armc3	UTSW	2	19292980	critical splice acceptor site	probably null
R5370:Armc3	UTSW	2	19286062	missense	probably benign	0.00
R5518:Armc3	UTSW	2	19297928	missense	probably benign	0.28
R5718:Armc3	UTSW	2	19303799	nonsense	probably null
R5913:Armc3	UTSW	2	19310047	missense	possibly damaging	0.65
R6211:Armc3	UTSW	2	19296803	critical splice acceptor site	probably null
R6245:Armc3	UTSW	2	19248705	missense	probably damaging	1.00
R6841:Armc3	UTSW	2	19201819	splice site	probably null
R7003:Armc3	UTSW	2	19270028	missense	probably damaging	1.00
R7190:Armc3	UTSW	2	19293136	missense	probably damaging	1.00
R7499:Armc3	UTSW	2	19285979	missense	probably benign	0.03
R7738:Armc3	UTSW	2	19288950	missense	probably damaging	0.99
R7844:Armc3	UTSW	2	19254018	missense	possibly damaging	0.90
R7919:Armc3	UTSW	2	19286095	missense	probably benign	0.00
R8060:Armc3	UTSW	2	19288909	missense	probably benign	0.08
R8111:Armc3	UTSW	2	19296863	missense	probably benign
R8406:Armc3	UTSW	2	19235554	missense	probably damaging	0.98
R8485:Armc3	UTSW	2	19293134	missense	probably damaging	1.00
R8773:Armc3	UTSW	2	19288856	missense	probably benign	0.01
R8940:Armc3	UTSW	2	19235582	missense	probably damaging	1.00
R9441:Armc3	UTSW	2	19248615	missense	possibly damaging	0.89
Z1177:Armc3	UTSW	2	19285991	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGGACTTCTGCCTCATCTGG -3'
(R):5'- TTGATCAACATTGGGAATGCAAAGG -3'

Sequencing Primer
(F):5'- GAAATGTCCCTCATAGGCTCATGTG -3'
(R):5'- TGCAAAGGGAAGATGTATGCC -3'

Posted On

2016-11-21