Incidental Mutation 'R5739:Olfr1312'
ID444664
Institutional Source Beutler Lab
Gene Symbol Olfr1312
Ensembl Gene ENSMUSG00000074947
Gene Nameolfactory receptor 1312
SynonymsGA_x6K02T2Q125-73090482-73089529, MOR245-20
MMRRC Submission 043351-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5739 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112038068-112050238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112042783 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 83 (F83S)
Ref Sequence ENSEMBL: ENSMUSP00000149430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099600] [ENSMUST00000213582] [ENSMUST00000213961] [ENSMUST00000215531]
Predicted Effect probably damaging
Transcript: ENSMUST00000099600
AA Change: F83S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097195
Gene: ENSMUSG00000074947
AA Change: F83S

DomainStartEndE-ValueType
Pfam:7tm_4 27 302 1.6e-43 PFAM
Pfam:7tm_1 38 284 1.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213582
AA Change: F83S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000213961
AA Change: F83S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215531
AA Change: F83S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,541 V356E possibly damaging Het
4931429L15Rik A T 9: 46,309,419 S50T probably benign Het
A930011G23Rik A G 5: 99,221,430 L529P probably damaging Het
Acer2 A T 4: 86,900,555 N147Y probably damaging Het
Adamtsl1 A G 4: 86,232,664 E353G probably damaging Het
Alg6 T C 4: 99,744,500 F60L probably benign Het
Ano6 A T 15: 95,913,379 D120V probably damaging Het
Armc3 A G 2: 19,253,917 D265G possibly damaging Het
Arntl G A 7: 113,285,031 R92Q probably damaging Het
Aurkc A T 7: 7,002,860 Y249F probably benign Het
Cacna2d2 A G 9: 107,512,329 I274V probably benign Het
Camk2n2 C A 16: 20,621,080 G39C probably damaging Het
Ccdc39 A G 3: 33,826,561 L419P possibly damaging Het
Cdh23 T C 10: 60,305,609 M3117V probably damaging Het
Celsr3 A G 9: 108,827,158 E280G probably benign Het
Cherp TGCTGGTGGTGGGG TG 8: 72,467,815 probably benign Het
Clcn6 A G 4: 148,014,189 V494A probably damaging Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
Crb2 T G 2: 37,793,654 V1056G probably damaging Het
Crtac1 A G 19: 42,302,173 F363S probably damaging Het
Dnaaf2 T C 12: 69,196,941 S449G probably benign Het
Dnah7b A T 1: 46,233,992 I2427F probably damaging Het
Dnah8 T A 17: 30,719,007 D1619E probably benign Het
Dock3 A T 9: 106,973,796 S836T possibly damaging Het
Donson A T 16: 91,681,229 probably null Het
Drc3 G A 11: 60,375,130 R215H possibly damaging Het
Entpd2 T C 2: 25,399,492 S329P possibly damaging Het
Eya2 T C 2: 165,761,937 S332P probably damaging Het
Fam83f T A 15: 80,692,005 Y286N probably damaging Het
Fat4 T C 3: 38,983,134 V3645A probably benign Het
G2e3 T C 12: 51,372,504 F668L possibly damaging Het
Gm14403 T A 2: 177,509,247 C329S probably damaging Het
Hmcn1 G A 1: 150,808,697 T374I probably benign Het
Hmcn1 A T 1: 150,758,474 probably null Het
Hrnr T C 3: 93,323,129 S225P unknown Het
Ifi202b C T 1: 173,971,352 probably null Het
Il10ra A T 9: 45,256,070 D394E possibly damaging Het
Itga2b A T 11: 102,465,909 D275E probably benign Het
Jaml A T 9: 45,088,728 D108V probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrrtm1 T C 6: 77,244,889 V443A probably damaging Het
Mkln1 T A 6: 31,496,702 S126R probably benign Het
Myo19 T C 11: 84,897,624 I354T probably damaging Het
Nucb1 A T 7: 45,501,660 L99Q probably damaging Het
Pask A G 1: 93,322,056 S541P probably benign Het
Pdpr A T 8: 111,134,620 I749F possibly damaging Het
Phyhipl T C 10: 70,559,569 D269G possibly damaging Het
Pkdcc A G 17: 83,215,794 D110G probably benign Het
Ppox A G 1: 171,279,996 L115P probably damaging Het
Ppp1r12c A G 7: 4,497,282 L94P probably damaging Het
Ppp6r2 T A 15: 89,259,073 M141K probably benign Het
Prl3d1 A T 13: 27,100,012 H188L probably benign Het
Psmb3 T A 11: 97,713,470 probably benign Het
Pxdn T A 12: 29,982,334 S150T probably benign Het
Ripor3 T C 2: 167,981,283 T903A probably damaging Het
Rnase4 T C 14: 51,104,849 L10S probably benign Het
Rnf224 T C 2: 25,236,000 T114A probably benign Het
Rp1l1 A T 14: 64,032,170 E1735V probably benign Het
Rrp1b T A 17: 32,045,976 Y60N probably damaging Het
Rsbn1l A T 5: 20,905,816 V508E probably damaging Het
Rubcnl T C 14: 75,040,941 probably null Het
Rxfp4 A G 3: 88,651,902 probably benign Het
Sdccag8 A G 1: 176,826,231 T85A probably benign Het
Slc46a1 A T 11: 78,467,149 I343F possibly damaging Het
Ssh2 A G 11: 77,449,813 D597G probably damaging Het
Syne2 T A 12: 75,997,465 V3942E possibly damaging Het
Timd4 T C 11: 46,817,746 S200P probably benign Het
Tmc5 G A 7: 118,666,611 probably null Het
Tmem8 T A 17: 26,120,451 F580I probably damaging Het
Trbv16 A G 6: 41,152,079 T66A probably benign Het
Ttc3 A T 16: 94,439,324 K1103* probably null Het
Ttc7b A G 12: 100,384,233 V458A probably damaging Het
Ubxn10 A G 4: 138,720,823 S181P probably benign Het
Vmn2r11 A G 5: 109,059,248 probably null Het
Vmn2r26 A T 6: 124,025,966 N112Y probably benign Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zc3h10 T C 10: 128,544,801 N229S probably benign Het
Zfp407 T C 18: 84,208,742 *2247W probably null Het
Zfyve1 C A 12: 83,575,136 V162L possibly damaging Het
Other mutations in Olfr1312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Olfr1312 APN 2 112042371 missense probably benign 0.00
IGL01650:Olfr1312 APN 2 112042375 missense possibly damaging 0.84
IGL02390:Olfr1312 APN 2 112042711 missense possibly damaging 0.84
IGL03392:Olfr1312 APN 2 112042976 missense probably benign 0.00
R1170:Olfr1312 UTSW 2 112042215 missense probably benign 0.45
R1620:Olfr1312 UTSW 2 112042246 missense probably benign 0.07
R2083:Olfr1312 UTSW 2 112042553 missense probably benign 0.05
R3605:Olfr1312 UTSW 2 112042823 missense probably benign
R4182:Olfr1312 UTSW 2 112042528 missense probably damaging 1.00
R6321:Olfr1312 UTSW 2 112042768 missense probably benign 0.07
R7231:Olfr1312 UTSW 2 112042366 missense probably damaging 1.00
R7365:Olfr1312 UTSW 2 112043014 missense possibly damaging 0.95
R7673:Olfr1312 UTSW 2 112042580 missense probably benign
R7978:Olfr1312 UTSW 2 112042178 missense possibly damaging 0.92
R8112:Olfr1312 UTSW 2 112042637 missense probably damaging 1.00
R8167:Olfr1312 UTSW 2 112042444 missense possibly damaging 0.91
Z1177:Olfr1312 UTSW 2 112042655 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCACTGAAAACAAGATGC -3'
(R):5'- CCTGGGACTCACCAATTCTTG -3'

Sequencing Primer
(F):5'- CACACCCTTGGGCTCATAATGG -3'
(R):5'- TCAACTATTCCTTTTTGTGTTCTCC -3'
Posted On2016-11-21