Incidental Mutation 'R5739:A930011G23Rik'
ID444680
Institutional Source Beutler Lab
Gene Symbol A930011G23Rik
Ensembl Gene ENSMUSG00000089809
Gene NameRIKEN cDNA A930011G23 gene
Synonyms
MMRRC Submission 043351-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5739 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location99297244-99729065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99221430 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 529 (L529P)
Ref Sequence ENSEMBL: ENSMUSP00000147997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031276] [ENSMUST00000166484] [ENSMUST00000168092] [ENSMUST00000209346]
Predicted Effect probably damaging
Transcript: ENSMUST00000031276
AA Change: L443P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031276
Gene: ENSMUSG00000089809
AA Change: L443P

DomainStartEndE-ValueType
RasGEFN 33 157 5.22e-4 SMART
RasGEF 201 454 3.26e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166484
AA Change: L401P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128947
Gene: ENSMUSG00000089809
AA Change: L401P

DomainStartEndE-ValueType
Blast:RasGEFN 33 123 6e-50 BLAST
RasGEF 159 412 3.26e-68 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168092
AA Change: L442P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129652
Gene: ENSMUSG00000089809
AA Change: L442P

DomainStartEndE-ValueType
RasGEFN 33 157 2.8e-4 SMART
RasGEF 200 453 3.26e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209346
AA Change: L529P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.8174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (82/82)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,541 V356E possibly damaging Het
4931429L15Rik A T 9: 46,309,419 S50T probably benign Het
Acer2 A T 4: 86,900,555 N147Y probably damaging Het
Adamtsl1 A G 4: 86,232,664 E353G probably damaging Het
Alg6 T C 4: 99,744,500 F60L probably benign Het
Ano6 A T 15: 95,913,379 D120V probably damaging Het
Armc3 A G 2: 19,253,917 D265G possibly damaging Het
Arntl G A 7: 113,285,031 R92Q probably damaging Het
Aurkc A T 7: 7,002,860 Y249F probably benign Het
Cacna2d2 A G 9: 107,512,329 I274V probably benign Het
Camk2n2 C A 16: 20,621,080 G39C probably damaging Het
Ccdc39 A G 3: 33,826,561 L419P possibly damaging Het
Cdh23 T C 10: 60,305,609 M3117V probably damaging Het
Celsr3 A G 9: 108,827,158 E280G probably benign Het
Cherp TGCTGGTGGTGGGG TG 8: 72,467,815 probably benign Het
Clcn6 A G 4: 148,014,189 V494A probably damaging Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
Crb2 T G 2: 37,793,654 V1056G probably damaging Het
Crtac1 A G 19: 42,302,173 F363S probably damaging Het
Dnaaf2 T C 12: 69,196,941 S449G probably benign Het
Dnah7b A T 1: 46,233,992 I2427F probably damaging Het
Dnah8 T A 17: 30,719,007 D1619E probably benign Het
Dock3 A T 9: 106,973,796 S836T possibly damaging Het
Donson A T 16: 91,681,229 probably null Het
Drc3 G A 11: 60,375,130 R215H possibly damaging Het
Entpd2 T C 2: 25,399,492 S329P possibly damaging Het
Eya2 T C 2: 165,761,937 S332P probably damaging Het
Fam83f T A 15: 80,692,005 Y286N probably damaging Het
Fat4 T C 3: 38,983,134 V3645A probably benign Het
G2e3 T C 12: 51,372,504 F668L possibly damaging Het
Gm14403 T A 2: 177,509,247 C329S probably damaging Het
Hmcn1 A T 1: 150,758,474 probably null Het
Hmcn1 G A 1: 150,808,697 T374I probably benign Het
Hrnr T C 3: 93,323,129 S225P unknown Het
Ifi202b C T 1: 173,971,352 probably null Het
Il10ra A T 9: 45,256,070 D394E possibly damaging Het
Itga2b A T 11: 102,465,909 D275E probably benign Het
Jaml A T 9: 45,088,728 D108V probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrrtm1 T C 6: 77,244,889 V443A probably damaging Het
Mkln1 T A 6: 31,496,702 S126R probably benign Het
Myo19 T C 11: 84,897,624 I354T probably damaging Het
Nucb1 A T 7: 45,501,660 L99Q probably damaging Het
Olfr1312 A G 2: 112,042,783 F83S probably damaging Het
Pask A G 1: 93,322,056 S541P probably benign Het
Pdpr A T 8: 111,134,620 I749F possibly damaging Het
Phyhipl T C 10: 70,559,569 D269G possibly damaging Het
Pkdcc A G 17: 83,215,794 D110G probably benign Het
Ppox A G 1: 171,279,996 L115P probably damaging Het
Ppp1r12c A G 7: 4,497,282 L94P probably damaging Het
Ppp6r2 T A 15: 89,259,073 M141K probably benign Het
Prl3d1 A T 13: 27,100,012 H188L probably benign Het
Psmb3 T A 11: 97,713,470 probably benign Het
Pxdn T A 12: 29,982,334 S150T probably benign Het
Ripor3 T C 2: 167,981,283 T903A probably damaging Het
Rnase4 T C 14: 51,104,849 L10S probably benign Het
Rnf224 T C 2: 25,236,000 T114A probably benign Het
Rp1l1 A T 14: 64,032,170 E1735V probably benign Het
Rrp1b T A 17: 32,045,976 Y60N probably damaging Het
Rsbn1l A T 5: 20,905,816 V508E probably damaging Het
Rubcnl T C 14: 75,040,941 probably null Het
Rxfp4 A G 3: 88,651,902 probably benign Het
Sdccag8 A G 1: 176,826,231 T85A probably benign Het
Slc46a1 A T 11: 78,467,149 I343F possibly damaging Het
Ssh2 A G 11: 77,449,813 D597G probably damaging Het
Syne2 T A 12: 75,997,465 V3942E possibly damaging Het
Timd4 T C 11: 46,817,746 S200P probably benign Het
Tmc5 G A 7: 118,666,611 probably null Het
Tmem8 T A 17: 26,120,451 F580I probably damaging Het
Trbv16 A G 6: 41,152,079 T66A probably benign Het
Ttc3 A T 16: 94,439,324 K1103* probably null Het
Ttc7b A G 12: 100,384,233 V458A probably damaging Het
Ubxn10 A G 4: 138,720,823 S181P probably benign Het
Vmn2r11 A G 5: 109,059,248 probably null Het
Vmn2r26 A T 6: 124,025,966 N112Y probably benign Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zc3h10 T C 10: 128,544,801 N229S probably benign Het
Zfp407 T C 18: 84,208,742 *2247W probably null Het
Zfyve1 C A 12: 83,575,136 V162L possibly damaging Het
Other mutations in A930011G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:A930011G23Rik APN 5 99243243 unclassified probably null
IGL00536:A930011G23Rik APN 5 99222383 missense probably damaging 1.00
IGL00848:A930011G23Rik APN 5 99222378 missense probably damaging 1.00
IGL01400:A930011G23Rik APN 5 99243101 missense probably damaging 1.00
IGL02421:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02421:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02422:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02422:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02423:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02423:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02424:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02424:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02427:A930011G23Rik APN 5 99233970 missense probably damaging 1.00
IGL02437:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02437:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02473:A930011G23Rik APN 5 99222995 missense probably damaging 1.00
IGL02498:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02498:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02499:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02499:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02537:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02537:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02609:A930011G23Rik APN 5 99233995 splice site probably benign
IGL02735:A930011G23Rik APN 5 99229377 missense probably damaging 1.00
IGL02735:A930011G23Rik APN 5 99229382 missense probably damaging 1.00
IGL02975:A930011G23Rik APN 5 99233925 missense possibly damaging 0.81
IGL03129:A930011G23Rik APN 5 99229379 missense probably damaging 0.98
IGL03139:A930011G23Rik APN 5 99243208 missense probably benign 0.00
IGL03239:A930011G23Rik APN 5 99233976 missense probably damaging 1.00
IGL03295:A930011G23Rik APN 5 99243056 splice site probably benign
R0011:A930011G23Rik UTSW 5 99232354 missense probably damaging 1.00
R0738:A930011G23Rik UTSW 5 99240953 missense probably benign 0.08
R0840:A930011G23Rik UTSW 5 99234688 missense probably benign 0.00
R1779:A930011G23Rik UTSW 5 99223038 splice site probably benign
R1799:A930011G23Rik UTSW 5 99234576 missense probably benign 0.01
R1992:A930011G23Rik UTSW 5 99233925 missense possibly damaging 0.81
R2054:A930011G23Rik UTSW 5 99228055 missense probably benign 0.01
R2157:A930011G23Rik UTSW 5 99232097 missense probably damaging 0.99
R2184:A930011G23Rik UTSW 5 99232369 missense possibly damaging 0.69
R4565:A930011G23Rik UTSW 5 99227947 intron probably benign
R4930:A930011G23Rik UTSW 5 99222404 missense possibly damaging 0.81
R5065:A930011G23Rik UTSW 5 99234573 missense probably benign 0.18
R5806:A930011G23Rik UTSW 5 99240872 missense probably benign 0.05
R8228:A930011G23Rik UTSW 5 99377121 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGGGCCTTCCTACAACAAG -3'
(R):5'- AATATAAATCTGAGTGTGCGGCGG -3'

Sequencing Primer
(F):5'- GGCACGCATATGGCTTTCCTG -3'
(R):5'- ATTAAGGGCCTTCTCAGCTCAGAG -3'
Posted On2016-11-21