Incidental Mutation 'R5739:Lrrtm1'
ID444683
Institutional Source Beutler Lab
Gene Symbol Lrrtm1
Ensembl Gene ENSMUSG00000060780
Gene Nameleucine rich repeat transmembrane neuronal 1
Synonyms4632401D06Rik
MMRRC Submission 043351-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5739 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location77242689-77257791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77244889 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 443 (V443A)
Ref Sequence ENSEMBL: ENSMUSP00000124373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020400] [ENSMUST00000075340] [ENSMUST00000159616] [ENSMUST00000159626] [ENSMUST00000160894] [ENSMUST00000161677] [ENSMUST00000161811] [ENSMUST00000161846]
Predicted Effect probably damaging
Transcript: ENSMUST00000020400
AA Change: V443A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020400
Gene: ENSMUSG00000060780
AA Change: V443A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075340
SMART Domains Protein: ENSMUSP00000074809
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 2e-104 PFAM
Pfam:Vinculin 331 866 7.7e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159616
AA Change: V443A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125207
Gene: ENSMUSG00000060780
AA Change: V443A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159626
SMART Domains Protein: ENSMUSP00000124376
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 18 337 3.4e-105 PFAM
Pfam:Vinculin 330 914 6.6e-214 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160894
SMART Domains Protein: ENSMUSP00000124764
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 352 2.1e-104 PFAM
Pfam:Vinculin 343 927 4.6e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161677
AA Change: V443A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124373
Gene: ENSMUSG00000060780
AA Change: V443A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
LRR 184 207 6.96e0 SMART
LRR 208 236 1.76e2 SMART
LRR 255 278 4.71e1 SMART
LRR 279 302 1.03e1 SMART
Blast:LRRCT 314 364 4e-13 BLAST
transmembrane domain 428 450 N/A INTRINSIC
low complexity region 467 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161811
SMART Domains Protein: ENSMUSP00000124948
Gene: ENSMUSG00000060780

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 38 70 1.06e0 SMART
LRR 64 87 5.56e0 SMART
LRR 88 111 1.03e1 SMART
LRR_TYP 112 135 2.71e-2 SMART
LRR_TYP 136 159 1.98e-4 SMART
LRR_TYP 160 183 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161846
SMART Domains Protein: ENSMUSP00000123714
Gene: ENSMUSG00000063063

DomainStartEndE-ValueType
Pfam:Vinculin 31 350 5.3e-105 PFAM
Pfam:Vinculin 344 879 2.1e-222 PFAM
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with grossly normal brain morphology. Mice homozygous for another knock-out allele exhibit impaired cognitive function and altered hippocampal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,541 V356E possibly damaging Het
4931429L15Rik A T 9: 46,309,419 S50T probably benign Het
A930011G23Rik A G 5: 99,221,430 L529P probably damaging Het
Acer2 A T 4: 86,900,555 N147Y probably damaging Het
Adamtsl1 A G 4: 86,232,664 E353G probably damaging Het
Alg6 T C 4: 99,744,500 F60L probably benign Het
Ano6 A T 15: 95,913,379 D120V probably damaging Het
Armc3 A G 2: 19,253,917 D265G possibly damaging Het
Arntl G A 7: 113,285,031 R92Q probably damaging Het
Aurkc A T 7: 7,002,860 Y249F probably benign Het
Cacna2d2 A G 9: 107,512,329 I274V probably benign Het
Camk2n2 C A 16: 20,621,080 G39C probably damaging Het
Ccdc39 A G 3: 33,826,561 L419P possibly damaging Het
Cdh23 T C 10: 60,305,609 M3117V probably damaging Het
Celsr3 A G 9: 108,827,158 E280G probably benign Het
Cherp TGCTGGTGGTGGGG TG 8: 72,467,815 probably benign Het
Clcn6 A G 4: 148,014,189 V494A probably damaging Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
Crb2 T G 2: 37,793,654 V1056G probably damaging Het
Crtac1 A G 19: 42,302,173 F363S probably damaging Het
Dnaaf2 T C 12: 69,196,941 S449G probably benign Het
Dnah7b A T 1: 46,233,992 I2427F probably damaging Het
Dnah8 T A 17: 30,719,007 D1619E probably benign Het
Dock3 A T 9: 106,973,796 S836T possibly damaging Het
Donson A T 16: 91,681,229 probably null Het
Drc3 G A 11: 60,375,130 R215H possibly damaging Het
Entpd2 T C 2: 25,399,492 S329P possibly damaging Het
Eya2 T C 2: 165,761,937 S332P probably damaging Het
Fam83f T A 15: 80,692,005 Y286N probably damaging Het
Fat4 T C 3: 38,983,134 V3645A probably benign Het
G2e3 T C 12: 51,372,504 F668L possibly damaging Het
Gm14403 T A 2: 177,509,247 C329S probably damaging Het
Hmcn1 G A 1: 150,808,697 T374I probably benign Het
Hmcn1 A T 1: 150,758,474 probably null Het
Hrnr T C 3: 93,323,129 S225P unknown Het
Ifi202b C T 1: 173,971,352 probably null Het
Il10ra A T 9: 45,256,070 D394E possibly damaging Het
Itga2b A T 11: 102,465,909 D275E probably benign Het
Jaml A T 9: 45,088,728 D108V probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Mkln1 T A 6: 31,496,702 S126R probably benign Het
Myo19 T C 11: 84,897,624 I354T probably damaging Het
Nucb1 A T 7: 45,501,660 L99Q probably damaging Het
Olfr1312 A G 2: 112,042,783 F83S probably damaging Het
Pask A G 1: 93,322,056 S541P probably benign Het
Pdpr A T 8: 111,134,620 I749F possibly damaging Het
Phyhipl T C 10: 70,559,569 D269G possibly damaging Het
Pkdcc A G 17: 83,215,794 D110G probably benign Het
Ppox A G 1: 171,279,996 L115P probably damaging Het
Ppp1r12c A G 7: 4,497,282 L94P probably damaging Het
Ppp6r2 T A 15: 89,259,073 M141K probably benign Het
Prl3d1 A T 13: 27,100,012 H188L probably benign Het
Psmb3 T A 11: 97,713,470 probably benign Het
Pxdn T A 12: 29,982,334 S150T probably benign Het
Ripor3 T C 2: 167,981,283 T903A probably damaging Het
Rnase4 T C 14: 51,104,849 L10S probably benign Het
Rnf224 T C 2: 25,236,000 T114A probably benign Het
Rp1l1 A T 14: 64,032,170 E1735V probably benign Het
Rrp1b T A 17: 32,045,976 Y60N probably damaging Het
Rsbn1l A T 5: 20,905,816 V508E probably damaging Het
Rubcnl T C 14: 75,040,941 probably null Het
Rxfp4 A G 3: 88,651,902 probably benign Het
Sdccag8 A G 1: 176,826,231 T85A probably benign Het
Slc46a1 A T 11: 78,467,149 I343F possibly damaging Het
Ssh2 A G 11: 77,449,813 D597G probably damaging Het
Syne2 T A 12: 75,997,465 V3942E possibly damaging Het
Timd4 T C 11: 46,817,746 S200P probably benign Het
Tmc5 G A 7: 118,666,611 probably null Het
Tmem8 T A 17: 26,120,451 F580I probably damaging Het
Trbv16 A G 6: 41,152,079 T66A probably benign Het
Ttc3 A T 16: 94,439,324 K1103* probably null Het
Ttc7b A G 12: 100,384,233 V458A probably damaging Het
Ubxn10 A G 4: 138,720,823 S181P probably benign Het
Vmn2r11 A G 5: 109,059,248 probably null Het
Vmn2r26 A T 6: 124,025,966 N112Y probably benign Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zc3h10 T C 10: 128,544,801 N229S probably benign Het
Zfp407 T C 18: 84,208,742 *2247W probably null Het
Zfyve1 C A 12: 83,575,136 V162L possibly damaging Het
Other mutations in Lrrtm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Lrrtm1 APN 6 77244063 missense probably benign 0.00
IGL01011:Lrrtm1 APN 6 77244235 unclassified probably null
IGL01125:Lrrtm1 APN 6 77244453 missense probably damaging 1.00
IGL01924:Lrrtm1 APN 6 77244186 missense possibly damaging 0.81
IGL02508:Lrrtm1 APN 6 77244591 missense probably damaging 1.00
IGL03005:Lrrtm1 APN 6 77244156 missense probably damaging 1.00
IGL03076:Lrrtm1 APN 6 77244585 missense probably damaging 1.00
R0077:Lrrtm1 UTSW 6 77243872 missense probably damaging 1.00
R0540:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0607:Lrrtm1 UTSW 6 77244628 missense probably damaging 1.00
R0927:Lrrtm1 UTSW 6 77244860 missense probably damaging 1.00
R1742:Lrrtm1 UTSW 6 77244091 missense probably damaging 1.00
R1762:Lrrtm1 UTSW 6 77244697 missense probably benign
R1933:Lrrtm1 UTSW 6 77244966 intron probably null
R1934:Lrrtm1 UTSW 6 77244966 intron probably null
R2180:Lrrtm1 UTSW 6 77244346 missense probably damaging 1.00
R2267:Lrrtm1 UTSW 6 77244013 missense probably damaging 0.97
R2914:Lrrtm1 UTSW 6 77244979 missense probably damaging 0.99
R2937:Lrrtm1 UTSW 6 77243652 missense probably benign 0.03
R2938:Lrrtm1 UTSW 6 77243652 missense probably benign 0.03
R4604:Lrrtm1 UTSW 6 77244144 missense probably damaging 1.00
R4908:Lrrtm1 UTSW 6 77244678 missense probably benign 0.01
R4910:Lrrtm1 UTSW 6 77244901 missense probably damaging 1.00
R6604:Lrrtm1 UTSW 6 77244238 missense possibly damaging 0.70
R6845:Lrrtm1 UTSW 6 77243881 missense probably benign 0.02
R7048:Lrrtm1 UTSW 6 77244169 missense probably damaging 1.00
R7203:Lrrtm1 UTSW 6 77243601 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCACCTGTGTGAGGATG -3'
(R):5'- CGTTGATGATAACCAGGGCC -3'

Sequencing Primer
(F):5'- CCGTCACTAACCGCAGTG -3'
(R):5'- GATGATAACCAGGGCCCCCTC -3'
Posted On2016-11-21