Incidental Mutation 'R5739:Timd4'
ID444701
Institutional Source Beutler Lab
Gene Symbol Timd4
Ensembl Gene ENSMUSG00000055546
Gene NameT cell immunoglobulin and mucin domain containing 4
SynonymsTim4, B430010N18Rik, TIM-4
MMRRC Submission 043351-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5739 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46810800-46844332 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46817746 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 200 (S200P)
Ref Sequence ENSEMBL: ENSMUSP00000069456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068877]
PDB Structure
Tim-4 [X-RAY DIFFRACTION]
Tim-4 in complex with sodium potassium tartrate [X-RAY DIFFRACTION]
Tim-4 in complex with phosphatidylserine [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000068877
AA Change: S200P

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000069456
Gene: ENSMUSG00000055546
AA Change: S200P

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
IG 25 132 3.59e-5 SMART
low complexity region 135 182 N/A INTRINSIC
low complexity region 248 271 N/A INTRINSIC
transmembrane domain 279 301 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage phagocytosis, altered macrophage physiology, and increased peritoneal lymphoid and meyloid cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,541 V356E possibly damaging Het
4931429L15Rik A T 9: 46,309,419 S50T probably benign Het
A930011G23Rik A G 5: 99,221,430 L529P probably damaging Het
Acer2 A T 4: 86,900,555 N147Y probably damaging Het
Adamtsl1 A G 4: 86,232,664 E353G probably damaging Het
Alg6 T C 4: 99,744,500 F60L probably benign Het
Ano6 A T 15: 95,913,379 D120V probably damaging Het
Armc3 A G 2: 19,253,917 D265G possibly damaging Het
Arntl G A 7: 113,285,031 R92Q probably damaging Het
Aurkc A T 7: 7,002,860 Y249F probably benign Het
Cacna2d2 A G 9: 107,512,329 I274V probably benign Het
Camk2n2 C A 16: 20,621,080 G39C probably damaging Het
Ccdc39 A G 3: 33,826,561 L419P possibly damaging Het
Cdh23 T C 10: 60,305,609 M3117V probably damaging Het
Celsr3 A G 9: 108,827,158 E280G probably benign Het
Cherp TGCTGGTGGTGGGG TG 8: 72,467,815 probably benign Het
Clcn6 A G 4: 148,014,189 V494A probably damaging Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
Crb2 T G 2: 37,793,654 V1056G probably damaging Het
Crtac1 A G 19: 42,302,173 F363S probably damaging Het
Dnaaf2 T C 12: 69,196,941 S449G probably benign Het
Dnah7b A T 1: 46,233,992 I2427F probably damaging Het
Dnah8 T A 17: 30,719,007 D1619E probably benign Het
Dock3 A T 9: 106,973,796 S836T possibly damaging Het
Donson A T 16: 91,681,229 probably null Het
Drc3 G A 11: 60,375,130 R215H possibly damaging Het
Entpd2 T C 2: 25,399,492 S329P possibly damaging Het
Eya2 T C 2: 165,761,937 S332P probably damaging Het
Fam83f T A 15: 80,692,005 Y286N probably damaging Het
Fat4 T C 3: 38,983,134 V3645A probably benign Het
G2e3 T C 12: 51,372,504 F668L possibly damaging Het
Gm14403 T A 2: 177,509,247 C329S probably damaging Het
Hmcn1 G A 1: 150,808,697 T374I probably benign Het
Hmcn1 A T 1: 150,758,474 probably null Het
Hrnr T C 3: 93,323,129 S225P unknown Het
Ifi202b C T 1: 173,971,352 probably null Het
Il10ra A T 9: 45,256,070 D394E possibly damaging Het
Itga2b A T 11: 102,465,909 D275E probably benign Het
Jaml A T 9: 45,088,728 D108V probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrrtm1 T C 6: 77,244,889 V443A probably damaging Het
Mkln1 T A 6: 31,496,702 S126R probably benign Het
Myo19 T C 11: 84,897,624 I354T probably damaging Het
Nucb1 A T 7: 45,501,660 L99Q probably damaging Het
Olfr1312 A G 2: 112,042,783 F83S probably damaging Het
Pask A G 1: 93,322,056 S541P probably benign Het
Pdpr A T 8: 111,134,620 I749F possibly damaging Het
Phyhipl T C 10: 70,559,569 D269G possibly damaging Het
Pkdcc A G 17: 83,215,794 D110G probably benign Het
Ppox A G 1: 171,279,996 L115P probably damaging Het
Ppp1r12c A G 7: 4,497,282 L94P probably damaging Het
Ppp6r2 T A 15: 89,259,073 M141K probably benign Het
Prl3d1 A T 13: 27,100,012 H188L probably benign Het
Psmb3 T A 11: 97,713,470 probably benign Het
Pxdn T A 12: 29,982,334 S150T probably benign Het
Ripor3 T C 2: 167,981,283 T903A probably damaging Het
Rnase4 T C 14: 51,104,849 L10S probably benign Het
Rnf224 T C 2: 25,236,000 T114A probably benign Het
Rp1l1 A T 14: 64,032,170 E1735V probably benign Het
Rrp1b T A 17: 32,045,976 Y60N probably damaging Het
Rsbn1l A T 5: 20,905,816 V508E probably damaging Het
Rubcnl T C 14: 75,040,941 probably null Het
Rxfp4 A G 3: 88,651,902 probably benign Het
Sdccag8 A G 1: 176,826,231 T85A probably benign Het
Slc46a1 A T 11: 78,467,149 I343F possibly damaging Het
Ssh2 A G 11: 77,449,813 D597G probably damaging Het
Syne2 T A 12: 75,997,465 V3942E possibly damaging Het
Tmc5 G A 7: 118,666,611 probably null Het
Tmem8 T A 17: 26,120,451 F580I probably damaging Het
Trbv16 A G 6: 41,152,079 T66A probably benign Het
Ttc3 A T 16: 94,439,324 K1103* probably null Het
Ttc7b A G 12: 100,384,233 V458A probably damaging Het
Ubxn10 A G 4: 138,720,823 S181P probably benign Het
Vmn2r11 A G 5: 109,059,248 probably null Het
Vmn2r26 A T 6: 124,025,966 N112Y probably benign Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zc3h10 T C 10: 128,544,801 N229S probably benign Het
Zfp407 T C 18: 84,208,742 *2247W probably null Het
Zfyve1 C A 12: 83,575,136 V162L possibly damaging Het
Other mutations in Timd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Timd4 APN 11 46820014 missense possibly damaging 0.61
IGL02247:Timd4 APN 11 46815731 missense probably damaging 1.00
IGL02803:Timd4 APN 11 46815694 missense probably damaging 1.00
IGL02991:Timd4 APN 11 46842147 splice site probably benign
R0318:Timd4 UTSW 11 46837071 missense probably benign 0.00
R0427:Timd4 UTSW 11 46819257 missense probably benign 0.00
R1175:Timd4 UTSW 11 46817671 missense probably damaging 1.00
R1185:Timd4 UTSW 11 46817648 missense probably damaging 0.99
R1185:Timd4 UTSW 11 46817648 missense probably damaging 0.99
R1185:Timd4 UTSW 11 46817648 missense probably damaging 0.99
R1635:Timd4 UTSW 11 46842162 missense possibly damaging 0.92
R2011:Timd4 UTSW 11 46820030 missense possibly damaging 0.79
R2012:Timd4 UTSW 11 46820030 missense possibly damaging 0.79
R4994:Timd4 UTSW 11 46815517 missense probably damaging 0.99
R5511:Timd4 UTSW 11 46819980 splice site probably null
R5991:Timd4 UTSW 11 46843203 makesense probably null
R6207:Timd4 UTSW 11 46815526 missense probably damaging 0.98
R6863:Timd4 UTSW 11 46815443 nonsense probably null
R7230:Timd4 UTSW 11 46810864 missense probably benign 0.01
R7254:Timd4 UTSW 11 46843189 missense probably benign 0.04
R7466:Timd4 UTSW 11 46817758 missense probably benign 0.01
R7750:Timd4 UTSW 11 46815527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCGATGCATCTTCTGTTGG -3'
(R):5'- GAGAACCCAAAATGCTGACTTTTC -3'

Sequencing Primer
(F):5'- TGTTGGTTACAGCCACAACAAC -3'
(R):5'- GCTGACTTTTCAAAAACATAAAGGG -3'
Posted On2016-11-21