Incidental Mutation 'R5739:Pxdn'
ID444708
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission 043351-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R5739 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29982334 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 150 (S150T)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118321] [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably benign
Transcript: ENSMUST00000118321
AA Change: S126T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113477
Gene: ENSMUSG00000020674
AA Change: S126T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122328
AA Change: S150T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: S150T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155318
Predicted Effect probably benign
Transcript: ENSMUST00000220271
Meta Mutation Damage Score 0.0934 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,541 V356E possibly damaging Het
4931429L15Rik A T 9: 46,309,419 S50T probably benign Het
A930011G23Rik A G 5: 99,221,430 L529P probably damaging Het
Acer2 A T 4: 86,900,555 N147Y probably damaging Het
Adamtsl1 A G 4: 86,232,664 E353G probably damaging Het
Alg6 T C 4: 99,744,500 F60L probably benign Het
Ano6 A T 15: 95,913,379 D120V probably damaging Het
Armc3 A G 2: 19,253,917 D265G possibly damaging Het
Arntl G A 7: 113,285,031 R92Q probably damaging Het
Aurkc A T 7: 7,002,860 Y249F probably benign Het
Cacna2d2 A G 9: 107,512,329 I274V probably benign Het
Camk2n2 C A 16: 20,621,080 G39C probably damaging Het
Ccdc39 A G 3: 33,826,561 L419P possibly damaging Het
Cdh23 T C 10: 60,305,609 M3117V probably damaging Het
Celsr3 A G 9: 108,827,158 E280G probably benign Het
Cherp TGCTGGTGGTGGGG TG 8: 72,467,815 probably benign Het
Clcn6 A G 4: 148,014,189 V494A probably damaging Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
Crb2 T G 2: 37,793,654 V1056G probably damaging Het
Crtac1 A G 19: 42,302,173 F363S probably damaging Het
Dnaaf2 T C 12: 69,196,941 S449G probably benign Het
Dnah7b A T 1: 46,233,992 I2427F probably damaging Het
Dnah8 T A 17: 30,719,007 D1619E probably benign Het
Dock3 A T 9: 106,973,796 S836T possibly damaging Het
Donson A T 16: 91,681,229 probably null Het
Drc3 G A 11: 60,375,130 R215H possibly damaging Het
Entpd2 T C 2: 25,399,492 S329P possibly damaging Het
Eya2 T C 2: 165,761,937 S332P probably damaging Het
Fam83f T A 15: 80,692,005 Y286N probably damaging Het
Fat4 T C 3: 38,983,134 V3645A probably benign Het
G2e3 T C 12: 51,372,504 F668L possibly damaging Het
Gm14403 T A 2: 177,509,247 C329S probably damaging Het
Hmcn1 G A 1: 150,808,697 T374I probably benign Het
Hmcn1 A T 1: 150,758,474 probably null Het
Hrnr T C 3: 93,323,129 S225P unknown Het
Ifi202b C T 1: 173,971,352 probably null Het
Il10ra A T 9: 45,256,070 D394E possibly damaging Het
Itga2b A T 11: 102,465,909 D275E probably benign Het
Jaml A T 9: 45,088,728 D108V probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrrtm1 T C 6: 77,244,889 V443A probably damaging Het
Mkln1 T A 6: 31,496,702 S126R probably benign Het
Myo19 T C 11: 84,897,624 I354T probably damaging Het
Nucb1 A T 7: 45,501,660 L99Q probably damaging Het
Olfr1312 A G 2: 112,042,783 F83S probably damaging Het
Pask A G 1: 93,322,056 S541P probably benign Het
Pdpr A T 8: 111,134,620 I749F possibly damaging Het
Phyhipl T C 10: 70,559,569 D269G possibly damaging Het
Pkdcc A G 17: 83,215,794 D110G probably benign Het
Ppox A G 1: 171,279,996 L115P probably damaging Het
Ppp1r12c A G 7: 4,497,282 L94P probably damaging Het
Ppp6r2 T A 15: 89,259,073 M141K probably benign Het
Prl3d1 A T 13: 27,100,012 H188L probably benign Het
Psmb3 T A 11: 97,713,470 probably benign Het
Ripor3 T C 2: 167,981,283 T903A probably damaging Het
Rnase4 T C 14: 51,104,849 L10S probably benign Het
Rnf224 T C 2: 25,236,000 T114A probably benign Het
Rp1l1 A T 14: 64,032,170 E1735V probably benign Het
Rrp1b T A 17: 32,045,976 Y60N probably damaging Het
Rsbn1l A T 5: 20,905,816 V508E probably damaging Het
Rubcnl T C 14: 75,040,941 probably null Het
Rxfp4 A G 3: 88,651,902 probably benign Het
Sdccag8 A G 1: 176,826,231 T85A probably benign Het
Slc46a1 A T 11: 78,467,149 I343F possibly damaging Het
Ssh2 A G 11: 77,449,813 D597G probably damaging Het
Syne2 T A 12: 75,997,465 V3942E possibly damaging Het
Timd4 T C 11: 46,817,746 S200P probably benign Het
Tmc5 G A 7: 118,666,611 probably null Het
Tmem8 T A 17: 26,120,451 F580I probably damaging Het
Trbv16 A G 6: 41,152,079 T66A probably benign Het
Ttc3 A T 16: 94,439,324 K1103* probably null Het
Ttc7b A G 12: 100,384,233 V458A probably damaging Het
Ubxn10 A G 4: 138,720,823 S181P probably benign Het
Vmn2r11 A G 5: 109,059,248 probably null Het
Vmn2r26 A T 6: 124,025,966 N112Y probably benign Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zc3h10 T C 10: 128,544,801 N229S probably benign Het
Zfp407 T C 18: 84,208,742 *2247W probably null Het
Zfyve1 C A 12: 83,575,136 V162L possibly damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGTACAAGGCAGCCTG -3'
(R):5'- ATGAGTGGATTTGACAGCTATGTGC -3'

Sequencing Primer
(F):5'- CTTGCCTCCATACACCGGG -3'
(R):5'- CCGAAGCATCATGGAAGT -3'
Posted On2016-11-21