Incidental Mutation 'R5740:Vmn1r52'
ID444745
Institutional Source Beutler Lab
Gene Symbol Vmn1r52
Ensembl Gene ENSMUSG00000060816
Gene Namevomeronasal 1 receptor 52
SynonymsV1ra7, VN3
MMRRC Submission 043196-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5740 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location90174808-90181248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90179194 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 160 (I160N)
Ref Sequence ENSEMBL: ENSMUSP00000154275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079832] [ENSMUST00000226520] [ENSMUST00000227100] [ENSMUST00000227578] [ENSMUST00000227893] [ENSMUST00000228385] [ENSMUST00000228394] [ENSMUST00000228665]
Predicted Effect probably benign
Transcript: ENSMUST00000079832
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078760
Gene: ENSMUSG00000060816
AA Change: I160N

DomainStartEndE-ValueType
Pfam:V1R 38 302 1e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204789
Predicted Effect probably benign
Transcript: ENSMUST00000226520
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000227100
Predicted Effect probably benign
Transcript: ENSMUST00000227578
Predicted Effect probably benign
Transcript: ENSMUST00000227893
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000228385
Predicted Effect probably benign
Transcript: ENSMUST00000228394
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000228665
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G A 10: 120,778,508 probably benign Het
Arrdc5 T A 17: 56,297,838 N150Y probably benign Het
Bag1 T C 4: 40,941,526 Q269R probably null Het
C7 T C 15: 5,057,040 N40D probably benign Het
Ccdc109b A T 3: 129,918,725 M167K probably benign Het
Ccnt1 T C 15: 98,544,500 I296V probably benign Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
F13a1 T C 13: 36,898,204 T509A probably benign Het
Fgg A T 3: 83,011,525 T282S probably benign Het
Fzd7 A G 1: 59,483,680 M241V probably benign Het
Gja1 G A 10: 56,388,189 V215M probably damaging Het
Golgb1 T C 16: 36,919,000 L2567P probably damaging Het
Grik2 T C 10: 49,113,477 N819D probably damaging Het
Grik4 C T 9: 42,808,567 R3H possibly damaging Het
Hecw2 T C 1: 53,887,603 Y1079C probably benign Het
Hivep3 A G 4: 120,096,023 E512G possibly damaging Het
Ino80 T C 2: 119,431,029 D718G probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Jak2 A G 19: 29,262,424 K73E possibly damaging Het
Lrba A G 3: 86,328,342 I918V probably damaging Het
M1ap T C 6: 82,981,922 V178A probably damaging Het
Mgat4c A T 10: 102,389,321 K465N possibly damaging Het
Naip1 T A 13: 100,432,501 probably null Het
Ncbp3 T A 11: 73,053,497 N108K possibly damaging Het
Npepps A T 11: 97,236,068 D455E possibly damaging Het
Olfr1453 T C 19: 13,027,562 M256V probably benign Het
Pan2 G A 10: 128,308,164 G128S probably damaging Het
Ppp3cb A T 14: 20,501,596 I489N possibly damaging Het
Sdccag8 A G 1: 176,831,150 T134A probably benign Het
Sh3tc1 T C 5: 35,707,055 E596G probably benign Het
Shank1 T C 7: 44,353,740 S1619P possibly damaging Het
Slc46a3 A T 5: 147,879,833 C387* probably null Het
Slc5a5 G T 8: 70,888,917 probably null Het
Ttn T C 2: 76,891,374 probably benign Het
Vangl1 T C 3: 102,184,134 D212G probably damaging Het
Vmn2r118 C T 17: 55,593,103 M600I probably benign Het
Vmn2r7 T C 3: 64,707,233 I387V probably benign Het
Zfp369 A G 13: 65,296,767 R575G probably benign Het
Other mutations in Vmn1r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Vmn1r52 APN 6 90178923 missense probably benign
IGL02102:Vmn1r52 APN 6 90179207 missense possibly damaging 0.92
IGL02583:Vmn1r52 APN 6 90179144 nonsense probably null
IGL02938:Vmn1r52 APN 6 90179313 missense possibly damaging 0.58
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0904:Vmn1r52 UTSW 6 90179464 missense probably damaging 0.98
R2190:Vmn1r52 UTSW 6 90179169 missense probably benign 0.12
R4184:Vmn1r52 UTSW 6 90179237 missense probably benign 0.00
R4906:Vmn1r52 UTSW 6 90178948 missense possibly damaging 0.63
R5475:Vmn1r52 UTSW 6 90178912 missense probably benign 0.04
R5689:Vmn1r52 UTSW 6 90179250 missense possibly damaging 0.95
R7263:Vmn1r52 UTSW 6 90179553 missense probably benign 0.00
R7337:Vmn1r52 UTSW 6 90179623 missense probably benign 0.31
R7374:Vmn1r52 UTSW 6 90179136 missense probably benign 0.08
R8161:Vmn1r52 UTSW 6 90179257 missense possibly damaging 0.73
R8699:Vmn1r52 UTSW 6 90178760 missense probably benign 0.02
R8747:Vmn1r52 UTSW 6 90179469 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CTGTTGAGTGTCTTCCAGGC -3'
(R):5'- TAGAATGGTCCTGAGGGCTC -3'

Sequencing Primer
(F):5'- GAGTGTCTTCCAGGCCATCATC -3'
(R):5'- AGTTCTGAAGGCGCTGGGAC -3'
Posted On2016-11-21