Incidental Mutation 'R5740:Vmn1r52'
ID 444745
Institutional Source Beutler Lab
Gene Symbol Vmn1r52
Ensembl Gene ENSMUSG00000060816
Gene Name vomeronasal 1 receptor 52
Synonyms V1ra7, VN3
MMRRC Submission 043196-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R5740 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 90155698-90156627 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90156176 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 160 (I160N)
Ref Sequence ENSEMBL: ENSMUSP00000154275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079832] [ENSMUST00000226520] [ENSMUST00000227100] [ENSMUST00000227578] [ENSMUST00000227893] [ENSMUST00000228394] [ENSMUST00000228665] [ENSMUST00000228385]
AlphaFold Q9EP79
Predicted Effect probably benign
Transcript: ENSMUST00000079832
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078760
Gene: ENSMUSG00000060816
AA Change: I160N

DomainStartEndE-ValueType
Pfam:V1R 38 302 1e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204789
Predicted Effect probably benign
Transcript: ENSMUST00000226520
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000227100
Predicted Effect probably benign
Transcript: ENSMUST00000227578
Predicted Effect probably benign
Transcript: ENSMUST00000227893
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000228394
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000228665
AA Change: I160N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000228385
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G A 10: 120,614,413 (GRCm39) probably benign Het
Arrdc5 T A 17: 56,604,838 (GRCm39) N150Y probably benign Het
Bag1 T C 4: 40,941,526 (GRCm39) Q269R probably null Het
C7 T C 15: 5,086,522 (GRCm39) N40D probably benign Het
Ccnt1 T C 15: 98,442,381 (GRCm39) I296V probably benign Het
Col19a1 C T 1: 24,376,996 (GRCm39) G450S probably damaging Het
F13a1 T C 13: 37,082,178 (GRCm39) T509A probably benign Het
Fgg A T 3: 82,918,832 (GRCm39) T282S probably benign Het
Fzd7 A G 1: 59,522,839 (GRCm39) M241V probably benign Het
Gja1 G A 10: 56,264,285 (GRCm39) V215M probably damaging Het
Golgb1 T C 16: 36,739,362 (GRCm39) L2567P probably damaging Het
Grik2 T C 10: 48,989,573 (GRCm39) N819D probably damaging Het
Grik4 C T 9: 42,719,863 (GRCm39) R3H possibly damaging Het
Hecw2 T C 1: 53,926,762 (GRCm39) Y1079C probably benign Het
Hivep3 A G 4: 119,953,220 (GRCm39) E512G possibly damaging Het
Ino80 T C 2: 119,261,510 (GRCm39) D718G probably damaging Het
Ints10 G A 8: 69,257,574 (GRCm39) R258K probably damaging Het
Jak2 A G 19: 29,239,824 (GRCm39) K73E possibly damaging Het
Lrba A G 3: 86,235,649 (GRCm39) I918V probably damaging Het
M1ap T C 6: 82,958,903 (GRCm39) V178A probably damaging Het
Mcub A T 3: 129,712,374 (GRCm39) M167K probably benign Het
Mgat4c A T 10: 102,225,182 (GRCm39) K465N possibly damaging Het
Naip1 T A 13: 100,569,009 (GRCm39) probably null Het
Ncbp3 T A 11: 72,944,323 (GRCm39) N108K possibly damaging Het
Npepps A T 11: 97,126,894 (GRCm39) D455E possibly damaging Het
Or5b101 T C 19: 13,004,926 (GRCm39) M256V probably benign Het
Pan2 G A 10: 128,144,033 (GRCm39) G128S probably damaging Het
Ppp3cb A T 14: 20,551,664 (GRCm39) I489N possibly damaging Het
Sdccag8 A G 1: 176,658,716 (GRCm39) T134A probably benign Het
Sh3tc1 T C 5: 35,864,399 (GRCm39) E596G probably benign Het
Shank1 T C 7: 44,003,164 (GRCm39) S1619P possibly damaging Het
Slc46a3 A T 5: 147,816,643 (GRCm39) C387* probably null Het
Slc5a5 G T 8: 71,341,561 (GRCm39) probably null Het
Ttn T C 2: 76,721,718 (GRCm39) probably benign Het
Vangl1 T C 3: 102,091,450 (GRCm39) D212G probably damaging Het
Vmn2r118 C T 17: 55,900,103 (GRCm39) M600I probably benign Het
Vmn2r7 T C 3: 64,614,654 (GRCm39) I387V probably benign Het
Zfp369 A G 13: 65,444,581 (GRCm39) R575G probably benign Het
Other mutations in Vmn1r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Vmn1r52 APN 6 90,155,905 (GRCm39) missense probably benign
IGL02102:Vmn1r52 APN 6 90,156,189 (GRCm39) missense possibly damaging 0.92
IGL02583:Vmn1r52 APN 6 90,156,126 (GRCm39) nonsense probably null
IGL02938:Vmn1r52 APN 6 90,156,295 (GRCm39) missense possibly damaging 0.58
R0233:Vmn1r52 UTSW 6 90,156,593 (GRCm39) missense possibly damaging 0.96
R0233:Vmn1r52 UTSW 6 90,156,593 (GRCm39) missense possibly damaging 0.96
R0904:Vmn1r52 UTSW 6 90,156,446 (GRCm39) missense probably damaging 0.98
R2190:Vmn1r52 UTSW 6 90,156,151 (GRCm39) missense probably benign 0.12
R4184:Vmn1r52 UTSW 6 90,156,219 (GRCm39) missense probably benign 0.00
R4906:Vmn1r52 UTSW 6 90,155,930 (GRCm39) missense possibly damaging 0.63
R5475:Vmn1r52 UTSW 6 90,155,894 (GRCm39) missense probably benign 0.04
R5689:Vmn1r52 UTSW 6 90,156,232 (GRCm39) missense possibly damaging 0.95
R7263:Vmn1r52 UTSW 6 90,156,535 (GRCm39) missense probably benign 0.00
R7337:Vmn1r52 UTSW 6 90,156,605 (GRCm39) missense probably benign 0.31
R7374:Vmn1r52 UTSW 6 90,156,118 (GRCm39) missense probably benign 0.08
R8161:Vmn1r52 UTSW 6 90,156,239 (GRCm39) missense possibly damaging 0.73
R8699:Vmn1r52 UTSW 6 90,155,742 (GRCm39) missense probably benign 0.02
R8747:Vmn1r52 UTSW 6 90,156,451 (GRCm39) missense probably benign 0.36
R9721:Vmn1r52 UTSW 6 90,156,008 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTGAGTGTCTTCCAGGC -3'
(R):5'- TAGAATGGTCCTGAGGGCTC -3'

Sequencing Primer
(F):5'- GAGTGTCTTCCAGGCCATCATC -3'
(R):5'- AGTTCTGAAGGCGCTGGGAC -3'
Posted On 2016-11-21