Mutagenetix > Incidental Mutations

Incidental Mutation 'R5740:Grik2'

444750

Institutional Source

Beutler Lab

Gene Symbol

Grik2

Ensembl Gene

ENSMUSG00000056073

Gene Name

glutamate receptor, ionotropic, kainate 2 (beta 2)

Synonyms

Glurbeta2, Glur-6, Glur6

MMRRC Submission

043196-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5740 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49094833-49788766 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49113477 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 819 (N819D)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218823]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079751
AA Change: N819D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: N819D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105484
AA Change: N819D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: N819D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105485
AA Change: N819D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: N819D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000105486
AA Change: N819D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: N819D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	3.8e-11	PFAM
Pfam:ANF_receptor	52	395	1.5e-74	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	6e-13	BLAST
low complexity region	875	891	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105487
AA Change: N819D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: N819D

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147808

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217673

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218441
AA Change: N819D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000218598
AA Change: N819D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218823
AA Change: N819D

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

unknown
Transcript: ENSMUST00000219509
AA Change: N258D

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513I03Rik	G	A	10: 120,778,508		probably benign	Het
Arrdc5	T	A	17: 56,297,838	N150Y	probably benign	Het
Bag1	T	C	4: 40,941,526	Q269R	probably null	Het
C7	T	C	15: 5,057,040	N40D	probably benign	Het
Ccdc109b	A	T	3: 129,918,725	M167K	probably benign	Het
Ccnt1	T	C	15: 98,544,500	I296V	probably benign	Het
Col19a1	C	T	1: 24,337,915	G450S	probably damaging	Het
F13a1	T	C	13: 36,898,204	T509A	probably benign	Het
Fgg	A	T	3: 83,011,525	T282S	probably benign	Het
Fzd7	A	G	1: 59,483,680	M241V	probably benign	Het
Gja1	G	A	10: 56,388,189	V215M	probably damaging	Het
Golgb1	T	C	16: 36,919,000	L2567P	probably damaging	Het
Grik4	C	T	9: 42,808,567	R3H	possibly damaging	Het
Hecw2	T	C	1: 53,887,603	Y1079C	probably benign	Het
Hivep3	A	G	4: 120,096,023	E512G	possibly damaging	Het
Ino80	T	C	2: 119,431,029	D718G	probably damaging	Het
Ints10	G	A	8: 68,804,922	R258K	probably damaging	Het
Jak2	A	G	19: 29,262,424	K73E	possibly damaging	Het
Lrba	A	G	3: 86,328,342	I918V	probably damaging	Het
M1ap	T	C	6: 82,981,922	V178A	probably damaging	Het
Mgat4c	A	T	10: 102,389,321	K465N	possibly damaging	Het
Naip1	T	A	13: 100,432,501		probably null	Het
Ncbp3	T	A	11: 73,053,497	N108K	possibly damaging	Het
Npepps	A	T	11: 97,236,068	D455E	possibly damaging	Het
Olfr1453	T	C	19: 13,027,562	M256V	probably benign	Het
Pan2	G	A	10: 128,308,164	G128S	probably damaging	Het
Ppp3cb	A	T	14: 20,501,596	I489N	possibly damaging	Het
Sdccag8	A	G	1: 176,831,150	T134A	probably benign	Het
Sh3tc1	T	C	5: 35,707,055	E596G	probably benign	Het
Shank1	T	C	7: 44,353,740	S1619P	possibly damaging	Het
Slc46a3	A	T	5: 147,879,833	C387*	probably null	Het
Slc5a5	G	T	8: 70,888,917		probably null	Het
Ttn	T	C	2: 76,891,374		probably benign	Het
Vangl1	T	C	3: 102,184,134	D212G	probably damaging	Het
Vmn1r52	T	A	6: 90,179,194	I160N	probably benign	Het
Vmn2r118	C	T	17: 55,593,103	M600I	probably benign	Het
Vmn2r7	T	C	3: 64,707,233	I387V	probably benign	Het
Zfp369	A	G	13: 65,296,767	R575G	probably benign	Het

Other mutations in Grik2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Grik2	APN	10	49355928	missense	possibly damaging	0.95
IGL00979:Grik2	APN	10	49355938	missense	probably damaging	1.00
IGL01012:Grik2	APN	10	49272956	missense	probably damaging	1.00
IGL01302:Grik2	APN	10	49244330	missense	probably damaging	0.99
IGL01657:Grik2	APN	10	49527986	critical splice donor site	probably null
IGL02162:Grik2	APN	10	49422575	missense	possibly damaging	0.77
IGL02317:Grik2	APN	10	49422615	missense	probably benign	0.16
IGL02512:Grik2	APN	10	49355912	missense	probably benign	0.00
IGL02650:Grik2	APN	10	49101235	missense	probably benign	0.03
IGL03283:Grik2	APN	10	49578269	missense	probably benign	0.00
BB004:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
BB014:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R0325:Grik2	UTSW	10	49240725	missense	probably damaging	1.00
R0492:Grik2	UTSW	10	49101164	missense	probably damaging	0.99
R0601:Grik2	UTSW	10	49422597	missense	probably damaging	1.00
R0844:Grik2	UTSW	10	49101115	missense	possibly damaging	0.81
R1333:Grik2	UTSW	10	49527991	missense	probably damaging	0.98
R1499:Grik2	UTSW	10	49132775	missense	probably damaging	1.00
R1660:Grik2	UTSW	10	49244343	nonsense	probably null
R1721:Grik2	UTSW	10	49523746	missense	possibly damaging	0.93
R1966:Grik2	UTSW	10	49355909	missense	probably damaging	1.00
R1974:Grik2	UTSW	10	49132827	missense	possibly damaging	0.85
R2246:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R3103:Grik2	UTSW	10	49240772	missense	probably damaging	1.00
R3974:Grik2	UTSW	10	49422654	missense	probably damaging	1.00
R4592:Grik2	UTSW	10	49422615	missense	possibly damaging	0.48
R4658:Grik2	UTSW	10	49523792	missense	possibly damaging	0.71
R4748:Grik2	UTSW	10	49535341	missense	possibly damaging	0.87
R4935:Grik2	UTSW	10	49240730	missense	probably damaging	1.00
R4977:Grik2	UTSW	10	49132745	missense	probably damaging	1.00
R5103:Grik2	UTSW	10	49496109	missense	probably benign	0.33
R5330:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5331:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5736:Grik2	UTSW	10	49404410	missense	probably damaging	0.96
R5747:Grik2	UTSW	10	49523774	missense	probably benign
R6015:Grik2	UTSW	10	49523863	splice site	probably null
R6311:Grik2	UTSW	10	49578138	missense	probably damaging	0.98
R6474:Grik2	UTSW	10	49132680	missense	probably benign
R6504:Grik2	UTSW	10	49356102	missense	probably damaging	1.00
R6591:Grik2	UTSW	10	49272925	nonsense	probably null
R6691:Grik2	UTSW	10	49272925	nonsense	probably null
R6776:Grik2	UTSW	10	49355989	missense	probably damaging	1.00
R7015:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R7094:Grik2	UTSW	10	49355916	missense	possibly damaging	0.75
R7153:Grik2	UTSW	10	49535367	missense	probably benign	0.00
R7229:Grik2	UTSW	10	49101416	splice site	probably null
R7402:Grik2	UTSW	10	49535397	missense	probably damaging	1.00
R7473:Grik2	UTSW	10	49113522	missense	probably benign	0.22
R7514:Grik2	UTSW	10	49523808	missense	probably damaging	0.99
R7526:Grik2	UTSW	10	49523822	missense	possibly damaging	0.56
R7657:Grik2	UTSW	10	49783151	missense	probably benign	0.11
R7681:Grik2	UTSW	10	49244380	missense	probably damaging	1.00
R7714:Grik2	UTSW	10	49419696	missense	probably damaging	0.97
R7927:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R7952:Grik2	UTSW	10	49422537	missense	probably benign	0.15
R7979:Grik2	UTSW	10	49404342	missense	probably benign	0.01
R8062:Grik2	UTSW	10	49240767	missense	probably damaging	1.00
R8222:Grik2	UTSW	10	49573648	missense	probably benign	0.29
R8406:Grik2	UTSW	10	49272767	missense	probably damaging	1.00
RF008:Grik2	UTSW	10	49244384	missense	probably damaging	1.00
X0062:Grik2	UTSW	10	49272920	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATTTCTCATGGTTGGAAATAGCAG -3'
(R):5'- ACACGATCCATTTCCTTTAGTGTG -3'

Sequencing Primer
(F):5'- TCATGGTTGGAAATAGCAGAAAATAG -3'
(R):5'- GGAGTCATTTTCTGTCATCCAAATAG -3'

Posted On

2016-11-21