Incidental Mutation 'R5740:Jak2'
ID444767
Institutional Source Beutler Lab
Gene Symbol Jak2
Ensembl Gene ENSMUSG00000024789
Gene NameJanus kinase 2
SynonymsC81284
MMRRC Submission 043196-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5740 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29251828-29313080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29262424 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 73 (K73E)
Ref Sequence ENSEMBL: ENSMUSP00000064394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025705] [ENSMUST00000065796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025705
AA Change: K73E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025705
Gene: ENSMUSG00000024789
AA Change: K73E

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065796
AA Change: K73E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064394
Gene: ENSMUSG00000024789
AA Change: K73E

DomainStartEndE-ValueType
B41 33 270 8.86e-56 SMART
SH2 397 487 3.03e-18 SMART
STYKc 545 805 1.95e-26 SMART
TyrKc 849 1123 8.61e-119 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a protein tyrosine kinase involved in a specific subset of cytokine receptor signaling pathways. It has been found to be constituitively associated with the prolactin receptor and is required for responses to gamma interferon. Mice that do not express an active protein for this gene exhibit embryonic lethality associated with the absence of definitive erythropoiesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations die during midgestation due to a failure of erythropoieses. Mice expressing a conditional allele activated in mammary tissue exhibit lactation deficiency due to impaired alveologenesis. Mice homozygous for a knock-in allele exhibit myeloproliferative neoplasm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik G A 10: 120,778,508 probably benign Het
Arrdc5 T A 17: 56,297,838 N150Y probably benign Het
Bag1 T C 4: 40,941,526 Q269R probably null Het
C7 T C 15: 5,057,040 N40D probably benign Het
Ccdc109b A T 3: 129,918,725 M167K probably benign Het
Ccnt1 T C 15: 98,544,500 I296V probably benign Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
F13a1 T C 13: 36,898,204 T509A probably benign Het
Fgg A T 3: 83,011,525 T282S probably benign Het
Fzd7 A G 1: 59,483,680 M241V probably benign Het
Gja1 G A 10: 56,388,189 V215M probably damaging Het
Golgb1 T C 16: 36,919,000 L2567P probably damaging Het
Grik2 T C 10: 49,113,477 N819D probably damaging Het
Grik4 C T 9: 42,808,567 R3H possibly damaging Het
Hecw2 T C 1: 53,887,603 Y1079C probably benign Het
Hivep3 A G 4: 120,096,023 E512G possibly damaging Het
Ino80 T C 2: 119,431,029 D718G probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Lrba A G 3: 86,328,342 I918V probably damaging Het
M1ap T C 6: 82,981,922 V178A probably damaging Het
Mgat4c A T 10: 102,389,321 K465N possibly damaging Het
Naip1 T A 13: 100,432,501 probably null Het
Ncbp3 T A 11: 73,053,497 N108K possibly damaging Het
Npepps A T 11: 97,236,068 D455E possibly damaging Het
Olfr1453 T C 19: 13,027,562 M256V probably benign Het
Pan2 G A 10: 128,308,164 G128S probably damaging Het
Ppp3cb A T 14: 20,501,596 I489N possibly damaging Het
Sdccag8 A G 1: 176,831,150 T134A probably benign Het
Sh3tc1 T C 5: 35,707,055 E596G probably benign Het
Shank1 T C 7: 44,353,740 S1619P possibly damaging Het
Slc46a3 A T 5: 147,879,833 C387* probably null Het
Slc5a5 G T 8: 70,888,917 probably null Het
Ttn T C 2: 76,891,374 probably benign Het
Vangl1 T C 3: 102,184,134 D212G probably damaging Het
Vmn1r52 T A 6: 90,179,194 I160N probably benign Het
Vmn2r118 C T 17: 55,593,103 M600I probably benign Het
Vmn2r7 T C 3: 64,707,233 I387V probably benign Het
Zfp369 A G 13: 65,296,767 R575G probably benign Het
Other mutations in Jak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Jak2 APN 19 29301647 missense probably damaging 1.00
IGL00951:Jak2 APN 19 29299583 missense probably damaging 1.00
IGL01300:Jak2 APN 19 29309683 missense probably damaging 1.00
IGL01800:Jak2 APN 19 29286293 splice site probably benign
IGL02035:Jak2 APN 19 29286408 missense probably benign 0.24
IGL02212:Jak2 APN 19 29287982 missense probably benign 0.01
IGL02447:Jak2 APN 19 29299614 missense probably damaging 1.00
R0001:Jak2 UTSW 19 29282387 missense probably benign 0.01
R0158:Jak2 UTSW 19 29311757 missense probably benign
R0217:Jak2 UTSW 19 29296650 critical splice donor site probably null
R0308:Jak2 UTSW 19 29311757 missense probably benign 0.15
R0344:Jak2 UTSW 19 29283629 missense probably damaging 1.00
R0398:Jak2 UTSW 19 29282388 missense possibly damaging 0.95
R0408:Jak2 UTSW 19 29286317 missense probably benign 0.38
R0453:Jak2 UTSW 19 29311838 missense probably benign 0.01
R0853:Jak2 UTSW 19 29284926 nonsense probably null
R1180:Jak2 UTSW 19 29282499 missense probably damaging 1.00
R1794:Jak2 UTSW 19 29299557 missense probably benign 0.00
R2247:Jak2 UTSW 19 29283636 missense probably benign 0.01
R3908:Jak2 UTSW 19 29291273 missense probably damaging 1.00
R4705:Jak2 UTSW 19 29294915 missense possibly damaging 0.82
R4744:Jak2 UTSW 19 29262256 missense probably benign 0.02
R4814:Jak2 UTSW 19 29301977 missense probably damaging 1.00
R4903:Jak2 UTSW 19 29275036 missense probably benign 0.03
R5602:Jak2 UTSW 19 29298339 missense probably benign 0.01
R5713:Jak2 UTSW 19 29271393 missense probably damaging 0.96
R5758:Jak2 UTSW 19 29309643 missense probably damaging 1.00
R5966:Jak2 UTSW 19 29283554 missense possibly damaging 0.94
R6285:Jak2 UTSW 19 29295659 missense probably benign 0.35
R6439:Jak2 UTSW 19 29309622 splice site probably null
R6624:Jak2 UTSW 19 29282589 missense probably damaging 0.99
R6649:Jak2 UTSW 19 29288710 missense probably benign 0.00
R6653:Jak2 UTSW 19 29288710 missense probably benign 0.00
R7084:Jak2 UTSW 19 29286398 missense possibly damaging 0.78
R7180:Jak2 UTSW 19 29282411 missense probably benign 0.01
R7261:Jak2 UTSW 19 29310985 missense possibly damaging 0.82
R7488:Jak2 UTSW 19 29298383 missense probably damaging 0.99
R7537:Jak2 UTSW 19 29298637 missense probably benign 0.00
R7757:Jak2 UTSW 19 29283546 missense probably benign
R7777:Jak2 UTSW 19 29276868 missense probably benign 0.32
R8050:Jak2 UTSW 19 29298332 missense probably damaging 0.98
R8345:Jak2 UTSW 19 29284870 missense probably damaging 1.00
R8524:Jak2 UTSW 19 29295705 missense probably damaging 0.99
X0058:Jak2 UTSW 19 29295711 missense possibly damaging 0.91
Z1176:Jak2 UTSW 19 29271398 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CACATCTCCTGTACATCAGAATGG -3'
(R):5'- CTACTGCGGTCTCAGCAAAC -3'

Sequencing Primer
(F):5'- CATCAGAATGGTGATATTCCTGGAAG -3'
(R):5'- TGCGGTCTCAGCAAACATTTACAG -3'
Posted On2016-11-21