Mutagenetix > Incidental Mutations

Incidental Mutation 'H8786:Adcy5'

44477

Institutional Source

Beutler Lab

Gene Symbol

Adcy5

Ensembl Gene

ENSMUSG00000022840

Gene Name

adenylate cyclase 5

Synonyms

AC5

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

H8786 (G3) of strain 617

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35154877-35305738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35267181 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 471 (I471V)

Ref Sequence

ENSEMBL: ENSMUSP00000110563 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114913]

Predicted Effect

probably damaging
Transcript: ENSMUST00000114913
AA Change: I471V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: I471V

Domain	Start	End	E-Value	Type
low complexity region	47	59	N/A	INTRINSIC
low complexity region	75	89	N/A	INTRINSIC
low complexity region	107	150	N/A	INTRINSIC
low complexity region	158	175	N/A	INTRINSIC
low complexity region	181	208	N/A	INTRINSIC
low complexity region	243	258	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	305	320	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
CYCc	424	623	2.62e-69	SMART
Pfam:DUF1053	669	762	1.8e-30	PFAM
transmembrane domain	794	816	N/A	INTRINSIC
transmembrane domain	837	856	N/A	INTRINSIC
transmembrane domain	910	932	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	985	1004	N/A	INTRINSIC
CYCc	1032	1240	2.98e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232470

Meta Mutation Damage Score

0.182

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	A	G	2: 19,494,094	Y363H	probably benign	Het
4933402N03Rik	T	A	7: 131,139,177	R103S	probably damaging	Het
Aars	A	G	8: 111,045,555	D459G	probably benign	Het
Adam25	A	T	8: 40,754,224	M176L	probably benign	Het
Ano8	A	T	8: 71,478,744		probably benign	Het
Arhgef28	T	A	13: 97,946,953	Q1136L	probably damaging	Het
Atp13a3	A	T	16: 30,359,725	C164*	probably null	Het
Avl9	G	A	6: 56,757,310	A625T	probably damaging	Het
Avpr1a	A	T	10: 122,449,468	M222L	probably benign	Het
B4galnt4	A	T	7: 141,071,322	M939L	probably damaging	Het
B4galt6	A	G	18: 20,688,944	F331S	probably benign	Het
C2cd2	G	T	16: 97,879,640	Q325K	possibly damaging	Het
Caml	T	G	13: 55,628,596	L216R	probably damaging	Het
Cd200r4	A	G	16: 44,833,373	T132A	possibly damaging	Het
Ces1h	A	C	8: 93,362,922	V283G	probably damaging	Het
Clptm1	A	T	7: 19,635,704	V427D	possibly damaging	Het
Drd1	T	A	13: 54,053,103	N357I	possibly damaging	Het
Foxq1	C	G	13: 31,559,458	S181W	probably damaging	Het
Gfra2	C	T	14: 70,978,378	T169M	possibly damaging	Het
Gm42542	T	C	6: 68,895,650		probably null	Het
Hoxa13	CGG	CGNGG	6: 52,260,636		probably null	Het
Hsd11b1	C	A	1: 193,240,252	A166S	probably benign	Het
Kcnab3	T	A	11: 69,328,267	F101L	probably damaging	Het
Klf6	C	A	13: 5,861,791	H51Q	probably damaging	Het
Krtap4-8	G	A	11: 99,780,072	P191L	unknown	Het
Lrrk2	T	A	15: 91,673,358	N26K	probably benign	Het
Mrgprd	T	C	7: 145,322,267	S292P	probably benign	Het
Ms4a8a	A	G	19: 11,076,361	I127T	possibly damaging	Het
Myo7a	T	G	7: 98,095,778	N280T	possibly damaging	Het
Nipal4	A	G	11: 46,150,477	F297S	probably damaging	Het
Npas1	A	G	7: 16,461,350	I351T	possibly damaging	Het
Olfr1245	C	A	2: 89,575,279	G149V	probably damaging	Het
Olfr311	A	T	11: 58,841,320	I69F	probably benign	Het
Olfr360	A	G	2: 37,068,329	E8G	probably benign	Het
Parp11	A	G	6: 127,471,635	T72A	probably damaging	Het
Pik3c3	T	C	18: 30,294,343	V300A	probably damaging	Het
Pik3cb	T	C	9: 99,046,559	E881G	possibly damaging	Het
Polr2h	T	A	16: 20,720,531	L57*	probably null	Het
Rela	T	A	19: 5,647,018	S418T	probably benign	Het
Rptn	A	G	3: 93,397,873	T838A	possibly damaging	Het
Sez6l2	T	A	7: 126,961,783	N413K	possibly damaging	Het
Slc6a2	A	G	8: 92,994,640	I466V	probably benign	Het
Slco4c1	A	T	1: 96,841,151	C329S	probably damaging	Het
Sppl2c	A	G	11: 104,186,865	M164V	probably benign	Het
Spta1	G	A	1: 174,179,839	V212M	probably damaging	Het
Sqor	A	C	2: 122,792,368	I142L	probably benign	Het
Suco	T	C	1: 161,852,851	E317G	probably damaging	Het
Tlk2	T	A	11: 105,254,979	I337N	possibly damaging	Het
Tln1	A	T	4: 43,544,589	N1113K	probably damaging	Het
Tmc2	A	G	2: 130,226,262	Y234C	probably damaging	Het
Tmem167	A	C	13: 90,098,466	K36N	probably damaging	Het
Trim72	T	C	7: 128,004,791	L103P	probably damaging	Het
Urb1	T	A	16: 90,769,469	M1477L	probably benign	Het
Vwa2	T	A	19: 56,909,732	M721K	possibly damaging	Het
Zcchc11	T	C	4: 108,550,815		probably null	Het
Zfp143	T	G	7: 110,094,368	D636E	probably damaging	Het

Other mutations in Adcy5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Adcy5	APN	16	35253213	missense	possibly damaging	0.49
IGL01583:Adcy5	APN	16	35283513	splice site	probably benign
IGL01608:Adcy5	APN	16	35272165	missense	probably damaging	1.00
IGL02097:Adcy5	APN	16	35272098	missense	probably damaging	1.00
IGL02122:Adcy5	APN	16	35283612	splice site	probably benign
IGL02532:Adcy5	APN	16	35272083	missense	possibly damaging	0.79
IGL02814:Adcy5	APN	16	35303649	missense	probably benign	0.08
IGL02877:Adcy5	APN	16	35298600	missense	probably damaging	1.00
IGL03026:Adcy5	APN	16	35157042	missense	probably benign	0.41
IGL03345:Adcy5	APN	16	35248814	missense	probably benign	0.05
H8562:Adcy5	UTSW	16	35267181	missense	probably damaging	1.00
R0050:Adcy5	UTSW	16	35304303	utr 3 prime	probably benign
R0091:Adcy5	UTSW	16	35270998	critical splice donor site	probably null
R0112:Adcy5	UTSW	16	35156178	missense	possibly damaging	0.85
R0398:Adcy5	UTSW	16	35269068	missense	probably damaging	1.00
R0457:Adcy5	UTSW	16	35274545	missense	probably benign	0.07
R0554:Adcy5	UTSW	16	35294017	missense	probably benign	0.26
R0698:Adcy5	UTSW	16	35290082	missense	possibly damaging	0.78
R0761:Adcy5	UTSW	16	35270825	splice site	probably benign
R0865:Adcy5	UTSW	16	35274471	missense	probably damaging	0.96
R0927:Adcy5	UTSW	16	35156243	missense	probably benign	0.32
R0945:Adcy5	UTSW	16	35290111	missense	probably benign
R1534:Adcy5	UTSW	16	35253259	missense	possibly damaging	0.92
R1565:Adcy5	UTSW	16	35268957	missense	probably damaging	1.00
R1721:Adcy5	UTSW	16	35298424	missense	probably damaging	1.00
R1839:Adcy5	UTSW	16	35248940	missense	probably damaging	1.00
R2047:Adcy5	UTSW	16	35290108	missense	possibly damaging	0.78
R3052:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3053:Adcy5	UTSW	16	35303716	missense	probably damaging	1.00
R3827:Adcy5	UTSW	16	35290097	missense	probably benign	0.03
R4398:Adcy5	UTSW	16	35268993	missense	probably damaging	1.00
R4700:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R4965:Adcy5	UTSW	16	35278502	missense	possibly damaging	0.82
R5229:Adcy5	UTSW	16	35269070	missense	probably damaging	0.99
R5456:Adcy5	UTSW	16	35298522	missense	probably damaging	1.00
R5586:Adcy5	UTSW	16	35157116	missense	probably damaging	0.99
R5757:Adcy5	UTSW	16	35272081	missense	probably damaging	1.00
R5959:Adcy5	UTSW	16	35298410	missense	probably damaging	1.00
R6011:Adcy5	UTSW	16	35157228	missense	probably benign	0.05
R6277:Adcy5	UTSW	16	35289526	missense	probably benign	0.02
R6296:Adcy5	UTSW	16	35303710	missense	probably damaging	1.00
R6379:Adcy5	UTSW	16	35293999	missense	probably benign	0.13
R6431:Adcy5	UTSW	16	35279237	missense	probably damaging	1.00
R6685:Adcy5	UTSW	16	35279216	missense	possibly damaging	0.49
R6728:Adcy5	UTSW	16	35157165	missense	possibly damaging	0.88
R6755:Adcy5	UTSW	16	35303634	missense	possibly damaging	0.95
R6887:Adcy5	UTSW	16	35298590	missense	possibly damaging	0.74
R7029:Adcy5	UTSW	16	35299648	missense	probably null	0.91
R7047:Adcy5	UTSW	16	35267215	missense	probably damaging	1.00
R7050:Adcy5	UTSW	16	35303700	missense	possibly damaging	0.88
R7102:Adcy5	UTSW	16	35299625	missense	probably damaging	1.00
R7150:Adcy5	UTSW	16	35298534	missense	probably damaging	1.00
R7242:Adcy5	UTSW	16	35156835	missense	probably damaging	1.00
R7387:Adcy5	UTSW	16	35272090	missense	probably damaging	1.00
V7732:Adcy5	UTSW	16	35283541	missense	probably benign	0.00
X0022:Adcy5	UTSW	16	35299456	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTCCCAAGGTCCGTGATACATCC -3'
(R):5'- GCCTGACTGATTTCTCCAACCCAAC -3'

Sequencing Primer
(F):5'- ctgtcctgtccttccttctc -3'
(R):5'- GCAGAGTAAAAACCTAGATTACCGTC -3'

Posted On

2013-06-11