Incidental Mutation 'R5741:Ano3'
ID 444770
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms B230324K02Rik, Tmem16c
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R5741 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 110485546-110780854 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 110488618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 938 (I938K)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect probably benign
Transcript: ENSMUST00000099623
AA Change: I938K

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: I938K

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 106,919,315 (GRCm39) F220C probably damaging Het
Acox3 C T 5: 35,765,668 (GRCm39) H140Y probably benign Het
Ap3m1 A C 14: 21,095,788 (GRCm39) I14S possibly damaging Het
Arg1 T C 10: 24,793,897 (GRCm39) T127A probably benign Het
Asah2 A G 19: 31,986,015 (GRCm39) Y552H probably damaging Het
Cfap97d2 A T 8: 13,784,835 (GRCm39) Q32L possibly damaging Het
Chst12 A G 5: 140,509,688 (GRCm39) N105S probably benign Het
Cped1 G A 6: 22,123,620 (GRCm39) V458I probably benign Het
Cyld T G 8: 89,471,474 (GRCm39) I786S probably damaging Het
Cyp2j8 C T 4: 96,332,880 (GRCm39) V489I probably benign Het
Dlgap4 T C 2: 156,552,968 (GRCm39) Y462H probably damaging Het
Dnah5 C A 15: 28,246,513 (GRCm39) A617D probably benign Het
Erc2 T A 14: 28,024,826 (GRCm39) probably null Het
Fancm A G 12: 65,148,389 (GRCm39) N668S probably benign Het
Gm5592 A G 7: 40,938,625 (GRCm39) I636V probably benign Het
Gtf2h2 A T 13: 100,617,066 (GRCm39) C247S probably benign Het
Hyal5 T A 6: 24,876,494 (GRCm39) H122Q probably damaging Het
Ints10 G A 8: 69,257,574 (GRCm39) R258K probably damaging Het
Kir3dl1 G A X: 135,427,231 (GRCm39) D56N probably damaging Het
Lrguk T A 6: 34,025,802 (GRCm39) D199E probably damaging Het
Lyst A G 13: 13,808,615 (GRCm39) D95G probably benign Het
Map2k1 A T 9: 64,121,883 (GRCm39) L30Q possibly damaging Het
Nell1 G A 7: 50,210,638 (GRCm39) probably null Het
Nfatc3 T A 8: 106,805,698 (GRCm39) I181N probably damaging Het
Nipbl T C 15: 8,354,133 (GRCm39) K1668R possibly damaging Het
Or5b113 A G 19: 13,342,847 (GRCm39) N285S probably damaging Het
Or7e170 A G 9: 19,794,857 (GRCm39) V248A possibly damaging Het
Or8d2 T A 9: 38,759,899 (GRCm39) L163* probably null Het
Otud7b C T 3: 96,051,615 (GRCm39) T189I probably damaging Het
Pkia A T 3: 7,507,105 (GRCm39) E62D probably benign Het
Plcb3 G A 19: 6,931,790 (GRCm39) Q1154* probably null Het
Pole4 T C 6: 82,628,447 (GRCm39) E105G probably damaging Het
Ppp1r3a A G 6: 14,719,882 (GRCm39) V344A probably damaging Het
Ptpn21 A T 12: 98,645,548 (GRCm39) L1130Q probably damaging Het
Rapgef5 A G 12: 117,719,764 (GRCm39) D564G probably damaging Het
Samhd1 C T 2: 156,954,751 (GRCm39) R387H probably benign Het
Spag1 A G 15: 36,183,849 (GRCm39) K65E possibly damaging Het
Spata31d1d A T 13: 59,876,500 (GRCm39) V345D possibly damaging Het
Spin1 G A 13: 51,303,171 (GRCm39) V255I possibly damaging Het
Tmem171 A G 13: 98,828,559 (GRCm39) V197A probably benign Het
Tmigd1 T C 11: 76,797,916 (GRCm39) V86A possibly damaging Het
Ttn T C 2: 76,542,417 (GRCm39) D31777G probably damaging Het
Tymp T A 15: 89,260,639 (GRCm39) M60L probably benign Het
Ugdh T C 5: 65,584,866 (GRCm39) T19A probably damaging Het
Vmn1r234 G T 17: 21,449,731 (GRCm39) C215F probably benign Het
Wnt5b T C 6: 119,410,690 (GRCm39) D250G probably damaging Het
Xrn1 T A 9: 95,927,604 (GRCm39) C1463S probably benign Het
Zfp831 T A 2: 174,486,945 (GRCm39) I540N possibly damaging Het
Zmynd8 T C 2: 165,681,937 (GRCm39) D189G probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110,601,395 (GRCm39) splice site probably benign
IGL01066:Ano3 APN 2 110,491,790 (GRCm39) missense probably null 0.00
IGL01696:Ano3 APN 2 110,498,082 (GRCm39) missense probably damaging 1.00
IGL01729:Ano3 APN 2 110,611,739 (GRCm39) splice site probably null
IGL01785:Ano3 APN 2 110,513,060 (GRCm39) missense probably damaging 1.00
IGL01786:Ano3 APN 2 110,513,060 (GRCm39) missense probably damaging 1.00
IGL01992:Ano3 APN 2 110,488,564 (GRCm39) missense probably damaging 1.00
IGL02098:Ano3 APN 2 110,496,786 (GRCm39) nonsense probably null
IGL02333:Ano3 APN 2 110,527,544 (GRCm39) splice site probably benign
IGL02346:Ano3 APN 2 110,601,271 (GRCm39) splice site probably benign
IGL02352:Ano3 APN 2 110,715,288 (GRCm39) nonsense probably null
IGL02359:Ano3 APN 2 110,715,288 (GRCm39) nonsense probably null
IGL02544:Ano3 APN 2 110,488,594 (GRCm39) missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110,496,329 (GRCm39) splice site probably benign
IGL02861:Ano3 APN 2 110,569,157 (GRCm39) missense probably damaging 1.00
IGL02948:Ano3 APN 2 110,527,363 (GRCm39) splice site probably benign
IGL03327:Ano3 APN 2 110,527,523 (GRCm39) missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110,527,469 (GRCm39) missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110,605,355 (GRCm39) missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110,527,763 (GRCm39) missense probably damaging 1.00
R0349:Ano3 UTSW 2 110,491,832 (GRCm39) missense probably damaging 1.00
R0426:Ano3 UTSW 2 110,491,519 (GRCm39) missense probably damaging 1.00
R0523:Ano3 UTSW 2 110,715,200 (GRCm39) missense probably benign 0.13
R0557:Ano3 UTSW 2 110,693,297 (GRCm39) splice site probably null
R0611:Ano3 UTSW 2 110,715,346 (GRCm39) missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110,528,321 (GRCm39) missense probably benign 0.03
R1459:Ano3 UTSW 2 110,711,174 (GRCm39) missense probably benign 0.00
R1460:Ano3 UTSW 2 110,513,103 (GRCm39) missense probably damaging 0.97
R1773:Ano3 UTSW 2 110,591,800 (GRCm39) missense probably damaging 1.00
R1874:Ano3 UTSW 2 110,715,217 (GRCm39) missense probably benign 0.00
R1919:Ano3 UTSW 2 110,715,352 (GRCm39) missense probably benign
R2185:Ano3 UTSW 2 110,605,390 (GRCm39) missense probably benign 0.01
R2280:Ano3 UTSW 2 110,513,104 (GRCm39) missense probably benign 0.22
R2281:Ano3 UTSW 2 110,513,104 (GRCm39) missense probably benign 0.22
R2348:Ano3 UTSW 2 110,614,088 (GRCm39) missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110,693,188 (GRCm39) missense probably benign
R2697:Ano3 UTSW 2 110,625,305 (GRCm39) missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110,715,345 (GRCm39) missense probably damaging 0.99
R3923:Ano3 UTSW 2 110,601,304 (GRCm39) missense probably damaging 1.00
R4352:Ano3 UTSW 2 110,576,239 (GRCm39) missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110,591,923 (GRCm39) splice site probably null
R4790:Ano3 UTSW 2 110,715,264 (GRCm39) missense probably benign
R4832:Ano3 UTSW 2 110,498,067 (GRCm39) missense probably damaging 1.00
R4916:Ano3 UTSW 2 110,601,365 (GRCm39) missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110,491,825 (GRCm39) missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110,576,215 (GRCm39) missense probably damaging 1.00
R5498:Ano3 UTSW 2 110,527,448 (GRCm39) missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110,715,340 (GRCm39) missense probably damaging 0.99
R5627:Ano3 UTSW 2 110,587,298 (GRCm39) missense possibly damaging 0.61
R5767:Ano3 UTSW 2 110,491,616 (GRCm39) missense probably damaging 1.00
R5883:Ano3 UTSW 2 110,711,209 (GRCm39) missense probably null 0.15
R5899:Ano3 UTSW 2 110,693,232 (GRCm39) missense probably benign 0.39
R5916:Ano3 UTSW 2 110,512,181 (GRCm39) missense probably benign 0.29
R6158:Ano3 UTSW 2 110,496,220 (GRCm39) missense probably damaging 1.00
R6315:Ano3 UTSW 2 110,527,384 (GRCm39) missense probably damaging 1.00
R6401:Ano3 UTSW 2 110,605,459 (GRCm39) missense probably benign 0.01
R6481:Ano3 UTSW 2 110,625,372 (GRCm39) missense probably benign 0.16
R6482:Ano3 UTSW 2 110,527,400 (GRCm39) missense probably damaging 1.00
R6587:Ano3 UTSW 2 110,628,249 (GRCm39) splice site probably null
R6811:Ano3 UTSW 2 110,711,212 (GRCm39) missense probably benign 0.03
R7048:Ano3 UTSW 2 110,513,116 (GRCm39) nonsense probably null
R7145:Ano3 UTSW 2 110,693,205 (GRCm39) missense probably benign 0.31
R7207:Ano3 UTSW 2 110,611,768 (GRCm39) missense probably damaging 0.96
R7215:Ano3 UTSW 2 110,496,277 (GRCm39) missense probably damaging 1.00
R7366:Ano3 UTSW 2 110,587,412 (GRCm39) missense probably damaging 1.00
R7371:Ano3 UTSW 2 110,715,194 (GRCm39) critical splice donor site probably null
R7568:Ano3 UTSW 2 110,780,638 (GRCm39) start gained probably benign
R7636:Ano3 UTSW 2 110,513,048 (GRCm39) nonsense probably null
R7888:Ano3 UTSW 2 110,496,773 (GRCm39) missense probably damaging 1.00
R7992:Ano3 UTSW 2 110,605,367 (GRCm39) missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110,498,128 (GRCm39) missense probably damaging 0.99
R8074:Ano3 UTSW 2 110,780,577 (GRCm39) start gained probably benign
R8111:Ano3 UTSW 2 110,614,058 (GRCm39) missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110,496,801 (GRCm39) missense probably damaging 1.00
R8297:Ano3 UTSW 2 110,491,616 (GRCm39) missense probably damaging 1.00
R8485:Ano3 UTSW 2 110,498,200 (GRCm39) critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110,496,180 (GRCm39) missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110,614,074 (GRCm39) missense probably benign 0.12
R9071:Ano3 UTSW 2 110,625,418 (GRCm39) critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110,576,243 (GRCm39) missense probably benign 0.06
R9073:Ano3 UTSW 2 110,576,243 (GRCm39) missense probably benign 0.06
R9315:Ano3 UTSW 2 110,528,287 (GRCm39) missense probably damaging 0.97
R9376:Ano3 UTSW 2 110,496,782 (GRCm39) missense probably damaging 1.00
R9588:Ano3 UTSW 2 110,528,342 (GRCm39) missense possibly damaging 0.91
R9697:Ano3 UTSW 2 110,496,253 (GRCm39) missense probably damaging 1.00
R9716:Ano3 UTSW 2 110,601,376 (GRCm39) missense probably damaging 0.97
R9748:Ano3 UTSW 2 110,488,640 (GRCm39) missense probably damaging 1.00
RF012:Ano3 UTSW 2 110,527,868 (GRCm39) missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110,527,381 (GRCm39) missense probably benign 0.30
X0058:Ano3 UTSW 2 110,527,763 (GRCm39) missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110,576,192 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACACTAACGGTACCTC -3'
(R):5'- GACTGTCAATGAATGGCATTTGTG -3'

Sequencing Primer
(F):5'- TCCCCTTTGGAGTAGCAGG -3'
(R):5'- TTTCCAATAGAAGTCTCGGGAGC -3'
Posted On 2016-11-21