Incidental Mutation 'R5741:Zmynd8'
ID444774
Institutional Source Beutler Lab
Gene Symbol Zmynd8
Ensembl Gene ENSMUSG00000039671
Gene Namezinc finger, MYND-type containing 8
Synonyms2010005I16Rik, ZMYND8, RACK7, 1110013E22Rik, 3632413B07Rik, Prkcbp1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5741 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165784152-165899016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165840017 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 189 (D189G)
Ref Sequence ENSEMBL: ENSMUSP00000136211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018050] [ENSMUST00000088113] [ENSMUST00000099084] [ENSMUST00000109262] [ENSMUST00000109266] [ENSMUST00000109269] [ENSMUST00000136842] [ENSMUST00000153655] [ENSMUST00000170272] [ENSMUST00000177633]
Predicted Effect probably damaging
Transcript: ENSMUST00000018050
AA Change: D194G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018050
Gene: ENSMUSG00000039671
AA Change: D194G

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 90 131 2.23e-11 SMART
BROMO 147 254 1.77e-17 SMART
Pfam:PWWP 275 349 4e-12 PFAM
Pfam:DUF3544 412 624 9.8e-112 PFAM
internal_repeat_2 640 701 9.06e-5 PROSPERO
low complexity region 770 805 N/A INTRINSIC
low complexity region 853 868 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
coiled coil region 916 978 N/A INTRINSIC
Pfam:zf-MYND 988 1022 2.2e-7 PFAM
low complexity region 1055 1075 N/A INTRINSIC
low complexity region 1142 1156 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088113
AA Change: D189G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085436
Gene: ENSMUSG00000039671
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 271 346 2.7e-11 PFAM
Pfam:DUF3544 408 617 2.1e-102 PFAM
internal_repeat_2 635 696 4.2e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
low complexity region 1050 1070 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099084
AA Change: D169G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096683
Gene: ENSMUSG00000039671
AA Change: D169G

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 4.1e-12 PFAM
Pfam:DUF3544 387 599 1e-111 PFAM
internal_repeat_2 615 676 4.95e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 819 844 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
coiled coil region 943 1005 N/A INTRINSIC
Pfam:zf-MYND 1015 1049 2.3e-7 PFAM
low complexity region 1082 1102 N/A INTRINSIC
low complexity region 1169 1183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109262
AA Change: D169G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104885
Gene: ENSMUSG00000039671
AA Change: D169G

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 1.2e-12 PFAM
Pfam:DUF3544 387 460 3.1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109266
AA Change: D214G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104889
Gene: ENSMUSG00000039671
AA Change: D214G

DomainStartEndE-ValueType
low complexity region 6 11 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 110 151 2.23e-11 SMART
BROMO 167 274 1.77e-17 SMART
Pfam:PWWP 295 369 4.1e-12 PFAM
Pfam:DUF3544 432 644 1e-111 PFAM
internal_repeat_2 660 721 8.36e-5 PROSPERO
low complexity region 790 825 N/A INTRINSIC
low complexity region 873 888 N/A INTRINSIC
low complexity region 895 907 N/A INTRINSIC
coiled coil region 936 998 N/A INTRINSIC
Pfam:zf-MYND 1008 1042 2.3e-7 PFAM
low complexity region 1075 1095 N/A INTRINSIC
low complexity region 1162 1176 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109269
AA Change: D198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104892
Gene: ENSMUSG00000039671
AA Change: D198G

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
PHD 94 135 2.23e-11 SMART
BROMO 151 258 1.77e-17 SMART
Pfam:PWWP 280 355 6.6e-11 PFAM
Pfam:DUF3544 417 626 2.6e-102 PFAM
internal_repeat_2 644 705 6.15e-5 PROSPERO
low complexity region 774 809 N/A INTRINSIC
low complexity region 848 873 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 931 943 N/A INTRINSIC
coiled coil region 972 1034 N/A INTRINSIC
low complexity region 1111 1131 N/A INTRINSIC
low complexity region 1198 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136842
SMART Domains Protein: ENSMUSP00000120631
Gene: ENSMUSG00000039671

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
PHD 96 137 2.23e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152682
Predicted Effect probably damaging
Transcript: ENSMUST00000153655
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120932
Gene: ENSMUSG00000039671
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 270 344 3.5e-12 PFAM
Pfam:DUF3544 407 480 6.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170272
AA Change: D169G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128680
Gene: ENSMUSG00000039671
AA Change: D169G

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 37 56 N/A INTRINSIC
PHD 65 106 2.23e-11 SMART
BROMO 122 229 1.77e-17 SMART
Pfam:PWWP 250 324 1.1e-11 PFAM
Pfam:DUF3544 387 599 1.9e-111 PFAM
internal_repeat_2 615 676 7.92e-5 PROSPERO
low complexity region 745 780 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
low complexity region 850 862 N/A INTRINSIC
coiled coil region 891 953 N/A INTRINSIC
Pfam:zf-MYND 963 997 1.1e-6 PFAM
low complexity region 1030 1050 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177633
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136211
Gene: ENSMUSG00000039671
AA Change: D189G

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 57 76 N/A INTRINSIC
PHD 85 126 2.23e-11 SMART
BROMO 142 249 1.77e-17 SMART
Pfam:PWWP 270 344 9.6e-12 PFAM
Pfam:DUF3544 407 619 1.8e-111 PFAM
internal_repeat_2 635 696 6.45e-5 PROSPERO
low complexity region 765 800 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
coiled coil region 911 973 N/A INTRINSIC
Pfam:zf-MYND 983 1017 6.7e-7 PFAM
low complexity region 1050 1070 N/A INTRINSIC
low complexity region 1137 1151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for activated C-kinase (RACK) protein. The encoded protein has been shown to bind in vitro to activated protein kinase C beta I. In addition, this protein is a cutaneous T-cell lymphoma-associated antigen. Finally, the protein contains a bromodomain and two zinc fingers, and is thought to be a transcriptional regulator. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 107,028,489 F220C probably damaging Het
4932443I19Rik A T 8: 13,734,835 Q32L possibly damaging Het
Acox3 C T 5: 35,608,324 H140Y probably benign Het
Ano3 A T 2: 110,658,273 I938K probably benign Het
Ap3m1 A C 14: 21,045,720 I14S possibly damaging Het
Arg1 T C 10: 24,917,999 T127A probably benign Het
Asah2 A G 19: 32,008,615 Y552H probably damaging Het
Chst12 A G 5: 140,523,933 N105S probably benign Het
Cped1 G A 6: 22,123,621 V458I probably benign Het
Cyld T G 8: 88,744,846 I786S probably damaging Het
Cyp2j8 C T 4: 96,444,643 V489I probably benign Het
Dlgap4 T C 2: 156,711,048 Y462H probably damaging Het
Dnah5 C A 15: 28,246,367 A617D probably benign Het
Erc2 T A 14: 28,302,869 probably null Het
Fancm A G 12: 65,101,615 N668S probably benign Het
Gm5592 A G 7: 41,289,201 I636V probably benign Het
Gtf2h2 A T 13: 100,480,558 C247S probably benign Het
Hyal5 T A 6: 24,876,495 H122Q probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrguk T A 6: 34,048,867 D199E probably damaging Het
Lyst A G 13: 13,634,030 D95G probably benign Het
Map2k1 A T 9: 64,214,601 L30Q possibly damaging Het
Nell1 G A 7: 50,560,890 probably null Het
Nfatc3 T A 8: 106,079,066 I181N probably damaging Het
Nipbl T C 15: 8,324,649 K1668R possibly damaging Het
Olfr1467 A G 19: 13,365,483 N285S probably damaging Het
Olfr862 A G 9: 19,883,561 V248A possibly damaging Het
Olfr924 T A 9: 38,848,603 L163* probably null Het
Otud7b C T 3: 96,144,304 T189I probably damaging Het
Pkia A T 3: 7,442,045 E62D probably benign Het
Plcb3 G A 19: 6,954,422 Q1154* probably null Het
Pole4 T C 6: 82,651,466 E105G probably damaging Het
Ppp1r3a A G 6: 14,719,883 V344A probably damaging Het
Ptpn21 A T 12: 98,679,289 L1130Q probably damaging Het
Rapgef5 A G 12: 117,756,029 D564G probably damaging Het
Samhd1 C T 2: 157,112,831 R387H probably benign Het
Spag1 A G 15: 36,183,703 K65E possibly damaging Het
Spata31d1d A T 13: 59,728,686 V345D possibly damaging Het
Spin1 G A 13: 51,149,135 V255I possibly damaging Het
Tmem171 A G 13: 98,692,051 V197A probably benign Het
Tmigd1 T C 11: 76,907,090 V86A possibly damaging Het
Ttn T C 2: 76,712,073 D31777G probably damaging Het
Tymp T A 15: 89,376,436 M60L probably benign Het
Ugdh T C 5: 65,427,523 T19A probably damaging Het
Vmn1r234 G T 17: 21,229,469 C215F probably benign Het
Wnt5b T C 6: 119,433,729 D250G probably damaging Het
Xrn1 T A 9: 96,045,551 C1463S probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Other mutations in Zmynd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Zmynd8 APN 2 165812814 missense probably damaging 1.00
IGL01311:Zmynd8 APN 2 165805209 missense probably damaging 1.00
IGL02317:Zmynd8 APN 2 165820572 missense possibly damaging 0.92
IGL02548:Zmynd8 APN 2 165833405 missense probably damaging 1.00
IGL02798:Zmynd8 APN 2 165852150 critical splice acceptor site probably null
IGL02933:Zmynd8 APN 2 165828318 missense possibly damaging 0.65
cain UTSW 2 165858053 critical splice donor site probably null
F5770:Zmynd8 UTSW 2 165812394 nonsense probably null
I1329:Zmynd8 UTSW 2 165828225 missense probably damaging 1.00
P0031:Zmynd8 UTSW 2 165820698 splice site probably benign
R0267:Zmynd8 UTSW 2 165828402 missense probably damaging 1.00
R0608:Zmynd8 UTSW 2 165787158 splice site probably null
R1663:Zmynd8 UTSW 2 165807885 missense probably benign 0.11
R2212:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3412:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3413:Zmynd8 UTSW 2 165815451 missense probably damaging 1.00
R3749:Zmynd8 UTSW 2 165805198 missense probably damaging 1.00
R3820:Zmynd8 UTSW 2 165815461 nonsense probably null
R3836:Zmynd8 UTSW 2 165858099 missense probably benign 0.05
R3957:Zmynd8 UTSW 2 165812475 missense probably damaging 0.99
R4379:Zmynd8 UTSW 2 165807938 splice site probably null
R4526:Zmynd8 UTSW 2 165807607 intron probably benign
R4739:Zmynd8 UTSW 2 165805329 missense probably damaging 1.00
R4838:Zmynd8 UTSW 2 165840034 nonsense probably null
R4932:Zmynd8 UTSW 2 165834951 missense possibly damaging 0.90
R4933:Zmynd8 UTSW 2 165834951 missense possibly damaging 0.90
R4997:Zmynd8 UTSW 2 165792816 missense probably benign 0.01
R5652:Zmynd8 UTSW 2 165807698 missense probably damaging 1.00
R6008:Zmynd8 UTSW 2 165842787 missense possibly damaging 0.77
R6242:Zmynd8 UTSW 2 165898947 missense possibly damaging 0.91
R6332:Zmynd8 UTSW 2 165838852 missense probably damaging 1.00
R6394:Zmynd8 UTSW 2 165846023 nonsense probably null
R6772:Zmynd8 UTSW 2 165807601 missense probably benign 0.35
R6970:Zmynd8 UTSW 2 165875750 missense probably damaging 1.00
R6986:Zmynd8 UTSW 2 165833415 missense probably damaging 1.00
R7229:Zmynd8 UTSW 2 165858053 critical splice donor site probably null
R7266:Zmynd8 UTSW 2 165807572 missense possibly damaging 0.49
R7296:Zmynd8 UTSW 2 165840009 missense probably damaging 0.98
R7642:Zmynd8 UTSW 2 165812426 missense probably damaging 1.00
R7818:Zmynd8 UTSW 2 165842831 missense probably damaging 0.97
V7580:Zmynd8 UTSW 2 165812394 nonsense probably null
V7581:Zmynd8 UTSW 2 165812394 nonsense probably null
V7583:Zmynd8 UTSW 2 165812394 nonsense probably null
Z1088:Zmynd8 UTSW 2 165828171 missense probably benign
Z1176:Zmynd8 UTSW 2 165828188 missense not run
Predicted Primers PCR Primer
(F):5'- GAACACCGCTTAGGATTTCAAC -3'
(R):5'- CTGGACCATGAACATGTCTGC -3'

Sequencing Primer
(F):5'- TTAGGATTTCAACATCCCCTGAGACG -3'
(R):5'- GACCATGAACATGTCTGCTTCTCAG -3'
Posted On2016-11-21