Incidental Mutation 'R5741:Otud7b'
ID444777
Institutional Source Beutler Lab
Gene Symbol Otud7b
Ensembl Gene ENSMUSG00000038495
Gene NameOTU domain containing 7B
Synonyms4930463P07Rik, 2900060B22Rik, Za20d1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5741 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location96104527-96161129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96144304 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 189 (T189I)
Ref Sequence ENSEMBL: ENSMUSP00000096449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035519] [ENSMUST00000090785] [ENSMUST00000098849] [ENSMUST00000132980] [ENSMUST00000138206]
Predicted Effect probably damaging
Transcript: ENSMUST00000035519
AA Change: T189I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046413
Gene: ENSMUSG00000038495
AA Change: T189I

DomainStartEndE-ValueType
PDB:2L2D|A 1 59 1e-25 PDB
low complexity region 112 124 N/A INTRINSIC
Pfam:OTU 189 359 4.9e-30 PFAM
low complexity region 482 498 N/A INTRINSIC
low complexity region 527 558 N/A INTRINSIC
low complexity region 821 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090785
AA Change: T189I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088291
Gene: ENSMUSG00000038495
AA Change: T189I

DomainStartEndE-ValueType
PDB:2L2D|A 1 59 1e-25 PDB
low complexity region 112 124 N/A INTRINSIC
Pfam:OTU 189 359 4.9e-30 PFAM
low complexity region 482 498 N/A INTRINSIC
low complexity region 527 558 N/A INTRINSIC
low complexity region 821 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098849
AA Change: T189I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096449
Gene: ENSMUSG00000038495
AA Change: T189I

DomainStartEndE-ValueType
PDB:2L2D|A 1 59 1e-25 PDB
low complexity region 112 124 N/A INTRINSIC
Pfam:OTU 189 359 4.7e-27 PFAM
low complexity region 482 498 N/A INTRINSIC
low complexity region 527 558 N/A INTRINSIC
Pfam:zf-A20 797 821 6.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132980
SMART Domains Protein: ENSMUSP00000115699
Gene: ENSMUSG00000038495

DomainStartEndE-ValueType
Pfam:UBA_4 6 44 8.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138206
AA Change: T189I

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121847
Gene: ENSMUSG00000038495
AA Change: T189I

DomainStartEndE-ValueType
Pfam:UBA_4 6 44 2.7e-7 PFAM
low complexity region 112 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146660
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, tertiary lymphoid hyperplasia, increased stimulated B cell proliferation and survival and decreased susceptibility to C. rodentium infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 107,028,489 F220C probably damaging Het
4932443I19Rik A T 8: 13,734,835 Q32L possibly damaging Het
Acox3 C T 5: 35,608,324 H140Y probably benign Het
Ano3 A T 2: 110,658,273 I938K probably benign Het
Ap3m1 A C 14: 21,045,720 I14S possibly damaging Het
Arg1 T C 10: 24,917,999 T127A probably benign Het
Asah2 A G 19: 32,008,615 Y552H probably damaging Het
Chst12 A G 5: 140,523,933 N105S probably benign Het
Cped1 G A 6: 22,123,621 V458I probably benign Het
Cyld T G 8: 88,744,846 I786S probably damaging Het
Cyp2j8 C T 4: 96,444,643 V489I probably benign Het
Dlgap4 T C 2: 156,711,048 Y462H probably damaging Het
Dnah5 C A 15: 28,246,367 A617D probably benign Het
Erc2 T A 14: 28,302,869 probably null Het
Fancm A G 12: 65,101,615 N668S probably benign Het
Gm5592 A G 7: 41,289,201 I636V probably benign Het
Gtf2h2 A T 13: 100,480,558 C247S probably benign Het
Hyal5 T A 6: 24,876,495 H122Q probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrguk T A 6: 34,048,867 D199E probably damaging Het
Lyst A G 13: 13,634,030 D95G probably benign Het
Map2k1 A T 9: 64,214,601 L30Q possibly damaging Het
Nell1 G A 7: 50,560,890 probably null Het
Nfatc3 T A 8: 106,079,066 I181N probably damaging Het
Nipbl T C 15: 8,324,649 K1668R possibly damaging Het
Olfr1467 A G 19: 13,365,483 N285S probably damaging Het
Olfr862 A G 9: 19,883,561 V248A possibly damaging Het
Olfr924 T A 9: 38,848,603 L163* probably null Het
Pkia A T 3: 7,442,045 E62D probably benign Het
Plcb3 G A 19: 6,954,422 Q1154* probably null Het
Pole4 T C 6: 82,651,466 E105G probably damaging Het
Ppp1r3a A G 6: 14,719,883 V344A probably damaging Het
Ptpn21 A T 12: 98,679,289 L1130Q probably damaging Het
Rapgef5 A G 12: 117,756,029 D564G probably damaging Het
Samhd1 C T 2: 157,112,831 R387H probably benign Het
Spag1 A G 15: 36,183,703 K65E possibly damaging Het
Spata31d1d A T 13: 59,728,686 V345D possibly damaging Het
Spin1 G A 13: 51,149,135 V255I possibly damaging Het
Tmem171 A G 13: 98,692,051 V197A probably benign Het
Tmigd1 T C 11: 76,907,090 V86A possibly damaging Het
Ttn T C 2: 76,712,073 D31777G probably damaging Het
Tymp T A 15: 89,376,436 M60L probably benign Het
Ugdh T C 5: 65,427,523 T19A probably damaging Het
Vmn1r234 G T 17: 21,229,469 C215F probably benign Het
Wnt5b T C 6: 119,433,729 D250G probably damaging Het
Xrn1 T A 9: 96,045,551 C1463S probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Zmynd8 T C 2: 165,840,017 D189G probably damaging Het
Other mutations in Otud7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Otud7b APN 3 96150980 splice site probably benign
IGL01651:Otud7b APN 3 96153490 nonsense probably null
IGL01941:Otud7b APN 3 96155459 missense probably benign 0.00
IGL02376:Otud7b APN 3 96155037 missense possibly damaging 0.48
IGL03047:Otud7b APN 3 96150984 splice site probably benign
IGL03189:Otud7b APN 3 96155478 missense probably benign
PIT4434001:Otud7b UTSW 3 96140465 missense probably damaging 1.00
R0605:Otud7b UTSW 3 96144959 unclassified probably benign
R1364:Otud7b UTSW 3 96151451 missense probably damaging 1.00
R1570:Otud7b UTSW 3 96155891 missense probably damaging 1.00
R2172:Otud7b UTSW 3 96153520 splice site probably null
R2199:Otud7b UTSW 3 96155772 missense probably damaging 1.00
R2842:Otud7b UTSW 3 96136594 missense probably damaging 1.00
R2914:Otud7b UTSW 3 96155955 missense probably benign 0.01
R4716:Otud7b UTSW 3 96150910 missense probably damaging 0.96
R4810:Otud7b UTSW 3 96136607 missense probably damaging 1.00
R4878:Otud7b UTSW 3 96136510 utr 5 prime probably benign
R5327:Otud7b UTSW 3 96155738 missense probably benign
R5376:Otud7b UTSW 3 96153524 splice site probably null
R5530:Otud7b UTSW 3 96141488 missense probably damaging 1.00
R5877:Otud7b UTSW 3 96151960 nonsense probably null
R6365:Otud7b UTSW 3 96155250 missense probably benign 0.03
R7095:Otud7b UTSW 3 96155237 missense probably benign 0.01
R7404:Otud7b UTSW 3 96136625 critical splice donor site probably null
R7699:Otud7b UTSW 3 96155963 missense probably damaging 0.98
R7793:Otud7b UTSW 3 96155211 missense probably benign 0.01
R7840:Otud7b UTSW 3 96155373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATGCTCAACAGATTCTACC -3'
(R):5'- AGGCAAGATTCTCCCATTCC -3'

Sequencing Primer
(F):5'- TATCAGGAGTTCAAGACCAGCCTTG -3'
(R):5'- CCCCTAAGTCTTGGCATGAAC -3'
Posted On2016-11-21