Mutagenetix > Incidental Mutation

Incidental Mutation 'R5741:Nfatc3'

444794

Institutional Source

Beutler Lab

Gene Symbol

Nfatc3

Ensembl Gene

ENSMUSG00000031902

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3

Synonyms

NFATx, NFAT4, D8Ertd281e

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5741 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106058840-106130537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106079066 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 181 (I181N)

Ref Sequence

ENSEMBL: ENSMUSP00000148551 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000109308
AA Change: I189N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: I189N

Domain	Start	End	E-Value	Type
low complexity region	153	182	N/A	INTRINSIC
low complexity region	205	225	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	286	305	N/A	INTRINSIC
Pfam:RHD_DNA_bind	434	593	4.9e-25	PFAM
IPT	600	699	1.19e-20	SMART
low complexity region	713	722	N/A	INTRINSIC
low complexity region	917	938	N/A	INTRINSIC
low complexity region	954	967	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211991
AA Change: I181N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212577

Predicted Effect

probably damaging
Transcript: ENSMUST00000212742
AA Change: I181N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212936

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810010H24Rik	T	G	11: 107,028,489	F220C	probably damaging	Het
4932443I19Rik	A	T	8: 13,734,835	Q32L	possibly damaging	Het
Acox3	C	T	5: 35,608,324	H140Y	probably benign	Het
Ano3	A	T	2: 110,658,273	I938K	probably benign	Het
Ap3m1	A	C	14: 21,045,720	I14S	possibly damaging	Het
Arg1	T	C	10: 24,917,999	T127A	probably benign	Het
Asah2	A	G	19: 32,008,615	Y552H	probably damaging	Het
Chst12	A	G	5: 140,523,933	N105S	probably benign	Het
Cped1	G	A	6: 22,123,621	V458I	probably benign	Het
Cyld	T	G	8: 88,744,846	I786S	probably damaging	Het
Cyp2j8	C	T	4: 96,444,643	V489I	probably benign	Het
Dlgap4	T	C	2: 156,711,048	Y462H	probably damaging	Het
Dnah5	C	A	15: 28,246,367	A617D	probably benign	Het
Erc2	T	A	14: 28,302,869		probably null	Het
Fancm	A	G	12: 65,101,615	N668S	probably benign	Het
Gm5592	A	G	7: 41,289,201	I636V	probably benign	Het
Gtf2h2	A	T	13: 100,480,558	C247S	probably benign	Het
Hyal5	T	A	6: 24,876,495	H122Q	probably damaging	Het
Ints10	G	A	8: 68,804,922	R258K	probably damaging	Het
Kir3dl1	G	A	X: 136,526,482	D56N	probably damaging	Het
Lrguk	T	A	6: 34,048,867	D199E	probably damaging	Het
Lyst	A	G	13: 13,634,030	D95G	probably benign	Het
Map2k1	A	T	9: 64,214,601	L30Q	possibly damaging	Het
Nell1	G	A	7: 50,560,890		probably null	Het
Nipbl	T	C	15: 8,324,649	K1668R	possibly damaging	Het
Olfr1467	A	G	19: 13,365,483	N285S	probably damaging	Het
Olfr862	A	G	9: 19,883,561	V248A	possibly damaging	Het
Olfr924	T	A	9: 38,848,603	L163*	probably null	Het
Otud7b	C	T	3: 96,144,304	T189I	probably damaging	Het
Pkia	A	T	3: 7,442,045	E62D	probably benign	Het
Plcb3	G	A	19: 6,954,422	Q1154*	probably null	Het
Pole4	T	C	6: 82,651,466	E105G	probably damaging	Het
Ppp1r3a	A	G	6: 14,719,883	V344A	probably damaging	Het
Ptpn21	A	T	12: 98,679,289	L1130Q	probably damaging	Het
Rapgef5	A	G	12: 117,756,029	D564G	probably damaging	Het
Samhd1	C	T	2: 157,112,831	R387H	probably benign	Het
Spag1	A	G	15: 36,183,703	K65E	possibly damaging	Het
Spata31d1d	A	T	13: 59,728,686	V345D	possibly damaging	Het
Spin1	G	A	13: 51,149,135	V255I	possibly damaging	Het
Tmem171	A	G	13: 98,692,051	V197A	probably benign	Het
Tmigd1	T	C	11: 76,907,090	V86A	possibly damaging	Het
Ttn	T	C	2: 76,712,073	D31777G	probably damaging	Het
Tymp	T	A	15: 89,376,436	M60L	probably benign	Het
Ugdh	T	C	5: 65,427,523	T19A	probably damaging	Het
Vmn1r234	G	T	17: 21,229,469	C215F	probably benign	Het
Wnt5b	T	C	6: 119,433,729	D250G	probably damaging	Het
Xrn1	T	A	9: 96,045,551	C1463S	probably benign	Het
Zfp831	T	A	2: 174,645,152	I540N	possibly damaging	Het
Zmynd8	T	C	2: 165,840,017	D189G	probably damaging	Het

Other mutations in Nfatc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Nfatc3	APN	8	106099177	missense	probably damaging	1.00
IGL01755:Nfatc3	APN	8	106127921	missense	probably benign	0.42
IGL02314:Nfatc3	APN	8	106078900	missense	probably benign	0.21
IGL02724:Nfatc3	APN	8	106108185	missense	probably benign	0.29
Kampf	UTSW	8	106099150	missense	probably benign	0.23
Struggles	UTSW	8	106083870	nonsense	probably null
PIT1430001:Nfatc3	UTSW	8	106059973	missense	possibly damaging	0.78
PIT4515001:Nfatc3	UTSW	8	106079203	missense	possibly damaging	0.94
R0088:Nfatc3	UTSW	8	106127942	missense	possibly damaging	0.90
R0348:Nfatc3	UTSW	8	106092195	missense	probably damaging	1.00
R0410:Nfatc3	UTSW	8	106096196	missense	probably damaging	1.00
R1509:Nfatc3	UTSW	8	106083854	missense	possibly damaging	0.46
R1702:Nfatc3	UTSW	8	106092160	missense	probably damaging	1.00
R1735:Nfatc3	UTSW	8	106083834	missense	probably damaging	1.00
R1736:Nfatc3	UTSW	8	106078850	missense	probably damaging	1.00
R1758:Nfatc3	UTSW	8	106099136	missense	probably damaging	1.00
R2370:Nfatc3	UTSW	8	106108455	missense	probably damaging	1.00
R2878:Nfatc3	UTSW	8	106092144	missense	probably damaging	1.00
R3802:Nfatc3	UTSW	8	106079645	missense	probably damaging	0.99
R3959:Nfatc3	UTSW	8	106099077	nonsense	probably null
R4006:Nfatc3	UTSW	8	106108839	missense	probably benign	0.00
R4079:Nfatc3	UTSW	8	106079491	missense	probably damaging	0.98
R4589:Nfatc3	UTSW	8	106079073	missense	probably damaging	1.00
R4818:Nfatc3	UTSW	8	106108379	missense	probably benign	0.00
R4907:Nfatc3	UTSW	8	106079727	missense	probably damaging	1.00
R5042:Nfatc3	UTSW	8	106108125	missense	probably benign	0.25
R5632:Nfatc3	UTSW	8	106079057	missense	probably damaging	1.00
R5885:Nfatc3	UTSW	8	106096312	missense	probably benign	0.00
R6439:Nfatc3	UTSW	8	106083870	nonsense	probably null
R6557:Nfatc3	UTSW	8	106119354	missense	probably benign	0.01
R6737:Nfatc3	UTSW	8	106083969	missense	probably damaging	1.00
R6925:Nfatc3	UTSW	8	106119322	missense	probably benign	0.00
R7260:Nfatc3	UTSW	8	106108946	missense	probably benign	0.00
R7429:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7430:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7526:Nfatc3	UTSW	8	106079083	missense	probably damaging	1.00
R7760:Nfatc3	UTSW	8	106108341	missense	possibly damaging	0.66
R8783:Nfatc3	UTSW	8	106099152	missense	possibly damaging	0.63
R8867:Nfatc3	UTSW	8	106079008	missense	probably damaging	1.00
R8978:Nfatc3	UTSW	8	106108770	missense	probably benign	0.03
R9021:Nfatc3	UTSW	8	106092113	missense	probably damaging	1.00
R9066:Nfatc3	UTSW	8	106099150	missense	probably benign	0.23
R9538:Nfatc3	UTSW	8	106108152	missense	probably benign	0.35
R9656:Nfatc3	UTSW	8	106104134	missense	probably damaging	1.00
X0063:Nfatc3	UTSW	8	106083939	missense	probably damaging	1.00
X0064:Nfatc3	UTSW	8	106108349	missense	probably benign	0.04
Z1177:Nfatc3	UTSW	8	106092066	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTGTCATCAAGGAACAGATGC -3'
(R):5'- GCTCAGCCAATTCTCATCAGTG -3'

Sequencing Primer
(F):5'- CTGTCATCAAGGAACAGATGCTCATG -3'
(R):5'- CAGCCAATTCTCATCAGTGATACTAG -3'

Posted On

2016-11-21