Incidental Mutation 'R5741:Ptpn21'
ID444805
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5741 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98679289 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1130 (L1130Q)
Ref Sequence ENSEMBL: ENSMUSP00000126975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably damaging
Transcript: ENSMUST00000085116
AA Change: L1130Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: L1130Q

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170188
AA Change: L1130Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: L1130Q

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221148
Predicted Effect probably benign
Transcript: ENSMUST00000221535
Predicted Effect probably benign
Transcript: ENSMUST00000221932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223321
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 107,028,489 F220C probably damaging Het
4932443I19Rik A T 8: 13,734,835 Q32L possibly damaging Het
Acox3 C T 5: 35,608,324 H140Y probably benign Het
Ano3 A T 2: 110,658,273 I938K probably benign Het
Ap3m1 A C 14: 21,045,720 I14S possibly damaging Het
Arg1 T C 10: 24,917,999 T127A probably benign Het
Asah2 A G 19: 32,008,615 Y552H probably damaging Het
Chst12 A G 5: 140,523,933 N105S probably benign Het
Cped1 G A 6: 22,123,621 V458I probably benign Het
Cyld T G 8: 88,744,846 I786S probably damaging Het
Cyp2j8 C T 4: 96,444,643 V489I probably benign Het
Dlgap4 T C 2: 156,711,048 Y462H probably damaging Het
Dnah5 C A 15: 28,246,367 A617D probably benign Het
Erc2 T A 14: 28,302,869 probably null Het
Fancm A G 12: 65,101,615 N668S probably benign Het
Gm5592 A G 7: 41,289,201 I636V probably benign Het
Gtf2h2 A T 13: 100,480,558 C247S probably benign Het
Hyal5 T A 6: 24,876,495 H122Q probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrguk T A 6: 34,048,867 D199E probably damaging Het
Lyst A G 13: 13,634,030 D95G probably benign Het
Map2k1 A T 9: 64,214,601 L30Q possibly damaging Het
Nell1 G A 7: 50,560,890 probably null Het
Nfatc3 T A 8: 106,079,066 I181N probably damaging Het
Nipbl T C 15: 8,324,649 K1668R possibly damaging Het
Olfr1467 A G 19: 13,365,483 N285S probably damaging Het
Olfr862 A G 9: 19,883,561 V248A possibly damaging Het
Olfr924 T A 9: 38,848,603 L163* probably null Het
Otud7b C T 3: 96,144,304 T189I probably damaging Het
Pkia A T 3: 7,442,045 E62D probably benign Het
Plcb3 G A 19: 6,954,422 Q1154* probably null Het
Pole4 T C 6: 82,651,466 E105G probably damaging Het
Ppp1r3a A G 6: 14,719,883 V344A probably damaging Het
Rapgef5 A G 12: 117,756,029 D564G probably damaging Het
Samhd1 C T 2: 157,112,831 R387H probably benign Het
Spag1 A G 15: 36,183,703 K65E possibly damaging Het
Spata31d1d A T 13: 59,728,686 V345D possibly damaging Het
Spin1 G A 13: 51,149,135 V255I possibly damaging Het
Tmem171 A G 13: 98,692,051 V197A probably benign Het
Tmigd1 T C 11: 76,907,090 V86A possibly damaging Het
Ttn T C 2: 76,712,073 D31777G probably damaging Het
Tymp T A 15: 89,376,436 M60L probably benign Het
Ugdh T C 5: 65,427,523 T19A probably damaging Het
Vmn1r234 G T 17: 21,229,469 C215F probably benign Het
Wnt5b T C 6: 119,433,729 D250G probably damaging Het
Xrn1 T A 9: 96,045,551 C1463S probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Zmynd8 T C 2: 165,840,017 D189G probably damaging Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4829:Ptpn21 UTSW 12 98689296 missense probably damaging 1.00
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
R7232:Ptpn21 UTSW 12 98688737 missense probably benign 0.17
R7289:Ptpn21 UTSW 12 98704191 missense probably benign 0.35
R7327:Ptpn21 UTSW 12 98680101 missense probably damaging 1.00
R7474:Ptpn21 UTSW 12 98737363 critical splice donor site probably null
R7748:Ptpn21 UTSW 12 98688772 missense probably benign 0.01
R7816:Ptpn21 UTSW 12 98682532 missense probably damaging 1.00
R7867:Ptpn21 UTSW 12 98705176 missense probably damaging 1.00
R7878:Ptpn21 UTSW 12 98715128 missense probably damaging 1.00
R7911:Ptpn21 UTSW 12 98688842 missense probably damaging 0.99
R7950:Ptpn21 UTSW 12 98705176 missense probably damaging 1.00
R7961:Ptpn21 UTSW 12 98715128 missense probably damaging 1.00
R7992:Ptpn21 UTSW 12 98688842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGTCTTCTATGTCATAGGCCATC -3'
(R):5'- GTTGCCCCTGAGTACTTTCG -3'

Sequencing Primer
(F):5'- TTCTGACAGTTGGAGCTGAGAACC -3'
(R):5'- GAGTACTTTCGTATCTCACTGATTC -3'
Posted On2016-11-21