Incidental Mutation 'R5741:Rapgef5'
ID 444806
Institutional Source Beutler Lab
Gene Symbol Rapgef5
Ensembl Gene ENSMUSG00000041992
Gene Name Rap guanine nucleotide exchange factor (GEF) 5
Synonyms mr-gef, D030051B22Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5741 (G1)
Quality Score 91
Status Not validated
Chromosome 12
Chromosomal Location 117480146-117723472 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 117719764 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 564 (D564G)
Ref Sequence ENSEMBL: ENSMUSP00000152339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109691] [ENSMUST00000222105] [ENSMUST00000222185]
AlphaFold Q8C0Q9
Predicted Effect probably damaging
Transcript: ENSMUST00000109691
AA Change: D798G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105313
Gene: ENSMUSG00000041992
AA Change: D798G

DomainStartEndE-ValueType
DEP 44 118 2.07e-12 SMART
RasGEFN 300 434 3.12e-34 SMART
Blast:RasGEF 441 502 7e-31 BLAST
RasGEF 574 814 1.52e-100 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000222105
AA Change: D596G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000222185
AA Change: D564G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 106,919,315 (GRCm39) F220C probably damaging Het
Acox3 C T 5: 35,765,668 (GRCm39) H140Y probably benign Het
Ano3 A T 2: 110,488,618 (GRCm39) I938K probably benign Het
Ap3m1 A C 14: 21,095,788 (GRCm39) I14S possibly damaging Het
Arg1 T C 10: 24,793,897 (GRCm39) T127A probably benign Het
Asah2 A G 19: 31,986,015 (GRCm39) Y552H probably damaging Het
Cfap97d2 A T 8: 13,784,835 (GRCm39) Q32L possibly damaging Het
Chst12 A G 5: 140,509,688 (GRCm39) N105S probably benign Het
Cped1 G A 6: 22,123,620 (GRCm39) V458I probably benign Het
Cyld T G 8: 89,471,474 (GRCm39) I786S probably damaging Het
Cyp2j8 C T 4: 96,332,880 (GRCm39) V489I probably benign Het
Dlgap4 T C 2: 156,552,968 (GRCm39) Y462H probably damaging Het
Dnah5 C A 15: 28,246,513 (GRCm39) A617D probably benign Het
Erc2 T A 14: 28,024,826 (GRCm39) probably null Het
Fancm A G 12: 65,148,389 (GRCm39) N668S probably benign Het
Gm5592 A G 7: 40,938,625 (GRCm39) I636V probably benign Het
Gtf2h2 A T 13: 100,617,066 (GRCm39) C247S probably benign Het
Hyal5 T A 6: 24,876,494 (GRCm39) H122Q probably damaging Het
Ints10 G A 8: 69,257,574 (GRCm39) R258K probably damaging Het
Kir3dl1 G A X: 135,427,231 (GRCm39) D56N probably damaging Het
Lrguk T A 6: 34,025,802 (GRCm39) D199E probably damaging Het
Lyst A G 13: 13,808,615 (GRCm39) D95G probably benign Het
Map2k1 A T 9: 64,121,883 (GRCm39) L30Q possibly damaging Het
Nell1 G A 7: 50,210,638 (GRCm39) probably null Het
Nfatc3 T A 8: 106,805,698 (GRCm39) I181N probably damaging Het
Nipbl T C 15: 8,354,133 (GRCm39) K1668R possibly damaging Het
Or5b113 A G 19: 13,342,847 (GRCm39) N285S probably damaging Het
Or7e170 A G 9: 19,794,857 (GRCm39) V248A possibly damaging Het
Or8d2 T A 9: 38,759,899 (GRCm39) L163* probably null Het
Otud7b C T 3: 96,051,615 (GRCm39) T189I probably damaging Het
Pkia A T 3: 7,507,105 (GRCm39) E62D probably benign Het
Plcb3 G A 19: 6,931,790 (GRCm39) Q1154* probably null Het
Pole4 T C 6: 82,628,447 (GRCm39) E105G probably damaging Het
Ppp1r3a A G 6: 14,719,882 (GRCm39) V344A probably damaging Het
Ptpn21 A T 12: 98,645,548 (GRCm39) L1130Q probably damaging Het
Samhd1 C T 2: 156,954,751 (GRCm39) R387H probably benign Het
Spag1 A G 15: 36,183,849 (GRCm39) K65E possibly damaging Het
Spata31d1d A T 13: 59,876,500 (GRCm39) V345D possibly damaging Het
Spin1 G A 13: 51,303,171 (GRCm39) V255I possibly damaging Het
Tmem171 A G 13: 98,828,559 (GRCm39) V197A probably benign Het
Tmigd1 T C 11: 76,797,916 (GRCm39) V86A possibly damaging Het
Ttn T C 2: 76,542,417 (GRCm39) D31777G probably damaging Het
Tymp T A 15: 89,260,639 (GRCm39) M60L probably benign Het
Ugdh T C 5: 65,584,866 (GRCm39) T19A probably damaging Het
Vmn1r234 G T 17: 21,449,731 (GRCm39) C215F probably benign Het
Wnt5b T C 6: 119,410,690 (GRCm39) D250G probably damaging Het
Xrn1 T A 9: 95,927,604 (GRCm39) C1463S probably benign Het
Zfp831 T A 2: 174,486,945 (GRCm39) I540N possibly damaging Het
Zmynd8 T C 2: 165,681,937 (GRCm39) D189G probably damaging Het
Other mutations in Rapgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Rapgef5 APN 12 117,677,917 (GRCm39) missense probably damaging 0.99
IGL01405:Rapgef5 APN 12 117,685,115 (GRCm39) missense probably benign 0.16
IGL01611:Rapgef5 APN 12 117,717,154 (GRCm39) splice site probably benign
IGL01720:Rapgef5 APN 12 117,577,055 (GRCm39) splice site probably benign
IGL01958:Rapgef5 APN 12 117,694,386 (GRCm39) missense probably benign 0.24
IGL02093:Rapgef5 APN 12 117,682,867 (GRCm39) missense probably damaging 0.98
IGL03210:Rapgef5 APN 12 117,706,607 (GRCm39) missense probably damaging 1.00
IGL03370:Rapgef5 APN 12 117,694,294 (GRCm39) missense probably damaging 1.00
IGL03397:Rapgef5 APN 12 117,712,176 (GRCm39) missense probably damaging 1.00
R0026:Rapgef5 UTSW 12 117,652,896 (GRCm39) missense probably benign 0.11
R0026:Rapgef5 UTSW 12 117,652,896 (GRCm39) missense probably benign 0.11
R0100:Rapgef5 UTSW 12 117,685,034 (GRCm39) missense probably benign 0.05
R0173:Rapgef5 UTSW 12 117,652,411 (GRCm39) missense probably benign 0.00
R0834:Rapgef5 UTSW 12 117,610,741 (GRCm39) splice site probably benign
R1331:Rapgef5 UTSW 12 117,685,084 (GRCm39) missense probably benign 0.04
R1505:Rapgef5 UTSW 12 117,652,354 (GRCm39) missense possibly damaging 0.92
R1546:Rapgef5 UTSW 12 117,610,721 (GRCm39) missense probably benign 0.00
R1577:Rapgef5 UTSW 12 117,558,911 (GRCm39) missense probably benign 0.28
R1597:Rapgef5 UTSW 12 117,621,940 (GRCm39) missense probably damaging 1.00
R1824:Rapgef5 UTSW 12 117,652,419 (GRCm39) critical splice donor site probably null
R2065:Rapgef5 UTSW 12 117,547,739 (GRCm39) nonsense probably null
R2117:Rapgef5 UTSW 12 117,677,799 (GRCm39) splice site probably null
R2169:Rapgef5 UTSW 12 117,679,130 (GRCm39) missense probably benign 0.25
R2903:Rapgef5 UTSW 12 117,677,854 (GRCm39) missense probably damaging 1.00
R3983:Rapgef5 UTSW 12 117,692,405 (GRCm39) missense possibly damaging 0.49
R4004:Rapgef5 UTSW 12 117,712,132 (GRCm39) missense probably damaging 0.99
R4652:Rapgef5 UTSW 12 117,677,863 (GRCm39) missense probably damaging 0.99
R4830:Rapgef5 UTSW 12 117,719,809 (GRCm39) missense probably damaging 1.00
R5282:Rapgef5 UTSW 12 117,703,379 (GRCm39) missense probably damaging 1.00
R5348:Rapgef5 UTSW 12 117,652,346 (GRCm39) missense probably benign 0.24
R5456:Rapgef5 UTSW 12 117,692,381 (GRCm39) splice site probably null
R5502:Rapgef5 UTSW 12 117,685,064 (GRCm39) missense probably damaging 1.00
R5771:Rapgef5 UTSW 12 117,685,061 (GRCm39) missense probably benign 0.45
R5905:Rapgef5 UTSW 12 117,712,161 (GRCm39) missense probably damaging 1.00
R5941:Rapgef5 UTSW 12 117,692,473 (GRCm39) missense probably damaging 1.00
R6228:Rapgef5 UTSW 12 117,685,398 (GRCm39) splice site probably null
R6233:Rapgef5 UTSW 12 117,703,453 (GRCm39) critical splice donor site probably null
R6376:Rapgef5 UTSW 12 117,684,988 (GRCm39) missense probably damaging 1.00
R6475:Rapgef5 UTSW 12 117,681,942 (GRCm39) missense probably damaging 1.00
R7063:Rapgef5 UTSW 12 117,652,864 (GRCm39) missense possibly damaging 0.91
R7410:Rapgef5 UTSW 12 117,685,063 (GRCm39) missense probably damaging 1.00
R7445:Rapgef5 UTSW 12 117,719,704 (GRCm39) missense probably benign 0.00
R7690:Rapgef5 UTSW 12 117,685,105 (GRCm39) missense possibly damaging 0.72
R7707:Rapgef5 UTSW 12 117,679,079 (GRCm39) missense probably damaging 1.00
R7815:Rapgef5 UTSW 12 117,719,702 (GRCm39) missense probably benign 0.10
R8461:Rapgef5 UTSW 12 117,677,844 (GRCm39) missense probably benign 0.00
R8475:Rapgef5 UTSW 12 117,681,965 (GRCm39) missense probably damaging 0.99
R8675:Rapgef5 UTSW 12 117,547,782 (GRCm39) missense probably damaging 1.00
R8682:Rapgef5 UTSW 12 117,545,432 (GRCm39) missense probably benign 0.06
R9018:Rapgef5 UTSW 12 117,712,132 (GRCm39) missense probably damaging 0.99
R9617:Rapgef5 UTSW 12 117,621,930 (GRCm39) missense probably benign 0.00
X0018:Rapgef5 UTSW 12 117,681,950 (GRCm39) missense probably damaging 1.00
Z1176:Rapgef5 UTSW 12 117,558,908 (GRCm39) missense probably damaging 1.00
Z1177:Rapgef5 UTSW 12 117,652,732 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TATCTTGAGACAAGGGAGAGCC -3'
(R):5'- ACATCACTTCCTGAACGTGC -3'

Sequencing Primer
(F):5'- GAGCCATTCTAGAGCTAACGTACTC -3'
(R):5'- ACTTCCTGAACGTGCTTTGG -3'
Posted On 2016-11-21