Incidental Mutation 'R5741:Nipbl'
ID 444812
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4933421G18Rik, 4921518A06Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R5741 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 8320101-8473947 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8354133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1668 (K1668R)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000052965
AA Change: K1668R

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: K1668R

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 106,919,315 (GRCm39) F220C probably damaging Het
Acox3 C T 5: 35,765,668 (GRCm39) H140Y probably benign Het
Ano3 A T 2: 110,488,618 (GRCm39) I938K probably benign Het
Ap3m1 A C 14: 21,095,788 (GRCm39) I14S possibly damaging Het
Arg1 T C 10: 24,793,897 (GRCm39) T127A probably benign Het
Asah2 A G 19: 31,986,015 (GRCm39) Y552H probably damaging Het
Cfap97d2 A T 8: 13,784,835 (GRCm39) Q32L possibly damaging Het
Chst12 A G 5: 140,509,688 (GRCm39) N105S probably benign Het
Cped1 G A 6: 22,123,620 (GRCm39) V458I probably benign Het
Cyld T G 8: 89,471,474 (GRCm39) I786S probably damaging Het
Cyp2j8 C T 4: 96,332,880 (GRCm39) V489I probably benign Het
Dlgap4 T C 2: 156,552,968 (GRCm39) Y462H probably damaging Het
Dnah5 C A 15: 28,246,513 (GRCm39) A617D probably benign Het
Erc2 T A 14: 28,024,826 (GRCm39) probably null Het
Fancm A G 12: 65,148,389 (GRCm39) N668S probably benign Het
Gm5592 A G 7: 40,938,625 (GRCm39) I636V probably benign Het
Gtf2h2 A T 13: 100,617,066 (GRCm39) C247S probably benign Het
Hyal5 T A 6: 24,876,494 (GRCm39) H122Q probably damaging Het
Ints10 G A 8: 69,257,574 (GRCm39) R258K probably damaging Het
Kir3dl1 G A X: 135,427,231 (GRCm39) D56N probably damaging Het
Lrguk T A 6: 34,025,802 (GRCm39) D199E probably damaging Het
Lyst A G 13: 13,808,615 (GRCm39) D95G probably benign Het
Map2k1 A T 9: 64,121,883 (GRCm39) L30Q possibly damaging Het
Nell1 G A 7: 50,210,638 (GRCm39) probably null Het
Nfatc3 T A 8: 106,805,698 (GRCm39) I181N probably damaging Het
Or5b113 A G 19: 13,342,847 (GRCm39) N285S probably damaging Het
Or7e170 A G 9: 19,794,857 (GRCm39) V248A possibly damaging Het
Or8d2 T A 9: 38,759,899 (GRCm39) L163* probably null Het
Otud7b C T 3: 96,051,615 (GRCm39) T189I probably damaging Het
Pkia A T 3: 7,507,105 (GRCm39) E62D probably benign Het
Plcb3 G A 19: 6,931,790 (GRCm39) Q1154* probably null Het
Pole4 T C 6: 82,628,447 (GRCm39) E105G probably damaging Het
Ppp1r3a A G 6: 14,719,882 (GRCm39) V344A probably damaging Het
Ptpn21 A T 12: 98,645,548 (GRCm39) L1130Q probably damaging Het
Rapgef5 A G 12: 117,719,764 (GRCm39) D564G probably damaging Het
Samhd1 C T 2: 156,954,751 (GRCm39) R387H probably benign Het
Spag1 A G 15: 36,183,849 (GRCm39) K65E possibly damaging Het
Spata31d1d A T 13: 59,876,500 (GRCm39) V345D possibly damaging Het
Spin1 G A 13: 51,303,171 (GRCm39) V255I possibly damaging Het
Tmem171 A G 13: 98,828,559 (GRCm39) V197A probably benign Het
Tmigd1 T C 11: 76,797,916 (GRCm39) V86A possibly damaging Het
Ttn T C 2: 76,542,417 (GRCm39) D31777G probably damaging Het
Tymp T A 15: 89,260,639 (GRCm39) M60L probably benign Het
Ugdh T C 5: 65,584,866 (GRCm39) T19A probably damaging Het
Vmn1r234 G T 17: 21,449,731 (GRCm39) C215F probably benign Het
Wnt5b T C 6: 119,410,690 (GRCm39) D250G probably damaging Het
Xrn1 T A 9: 95,927,604 (GRCm39) C1463S probably benign Het
Zfp831 T A 2: 174,486,945 (GRCm39) I540N possibly damaging Het
Zmynd8 T C 2: 165,681,937 (GRCm39) D189G probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8,396,157 (GRCm39) missense probably damaging 0.98
IGL00712:Nipbl APN 15 8,398,958 (GRCm39) missense probably damaging 0.97
IGL00789:Nipbl APN 15 8,326,353 (GRCm39) missense probably damaging 1.00
IGL01025:Nipbl APN 15 8,379,939 (GRCm39) missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8,379,981 (GRCm39) missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8,340,693 (GRCm39) missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8,380,023 (GRCm39) missense probably benign
IGL01723:Nipbl APN 15 8,364,555 (GRCm39) missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8,391,305 (GRCm39) missense probably benign 0.13
IGL02398:Nipbl APN 15 8,356,574 (GRCm39) missense probably damaging 1.00
IGL02437:Nipbl APN 15 8,388,558 (GRCm39) missense probably damaging 1.00
IGL02450:Nipbl APN 15 8,373,058 (GRCm39) missense probably damaging 0.99
IGL02477:Nipbl APN 15 8,353,131 (GRCm39) splice site probably null
IGL02547:Nipbl APN 15 8,381,082 (GRCm39) missense probably benign
IGL02678:Nipbl APN 15 8,380,594 (GRCm39) missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8,325,037 (GRCm39) missense probably benign 0.34
IGL03003:Nipbl APN 15 8,379,798 (GRCm39) missense probably damaging 1.00
IGL03117:Nipbl APN 15 8,361,936 (GRCm39) missense probably damaging 1.00
IGL03162:Nipbl APN 15 8,368,463 (GRCm39) missense probably benign 0.37
IGL03224:Nipbl APN 15 8,322,569 (GRCm39) missense probably damaging 0.98
IGL03339:Nipbl APN 15 8,380,360 (GRCm39) missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8,380,216 (GRCm39) missense probably benign
R3620_nipbl_616 UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R0271:Nipbl UTSW 15 8,391,221 (GRCm39) missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347:Nipbl UTSW 15 8,380,216 (GRCm39) missense probably benign
R0422:Nipbl UTSW 15 8,381,112 (GRCm39) missense probably benign
R0486:Nipbl UTSW 15 8,368,354 (GRCm39) splice site probably benign
R0652:Nipbl UTSW 15 8,332,964 (GRCm39) missense probably benign 0.23
R0667:Nipbl UTSW 15 8,390,488 (GRCm39) missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8,322,562 (GRCm39) splice site probably null
R0726:Nipbl UTSW 15 8,381,039 (GRCm39) missense probably benign
R0881:Nipbl UTSW 15 8,337,096 (GRCm39) missense probably damaging 0.98
R0904:Nipbl UTSW 15 8,391,202 (GRCm39) missense probably benign
R0969:Nipbl UTSW 15 8,321,712 (GRCm39) missense probably damaging 1.00
R1401:Nipbl UTSW 15 8,401,657 (GRCm39) missense probably damaging 0.97
R1479:Nipbl UTSW 15 8,379,773 (GRCm39) missense probably benign 0.00
R1495:Nipbl UTSW 15 8,380,764 (GRCm39) missense probably benign 0.00
R1609:Nipbl UTSW 15 8,396,148 (GRCm39) missense probably damaging 1.00
R1679:Nipbl UTSW 15 8,332,396 (GRCm39) missense probably benign 0.31
R1756:Nipbl UTSW 15 8,368,035 (GRCm39) missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8,348,972 (GRCm39) missense probably damaging 1.00
R1835:Nipbl UTSW 15 8,373,001 (GRCm39) missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8,356,616 (GRCm39) missense probably damaging 1.00
R1914:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8,379,771 (GRCm39) missense probably damaging 1.00
R2046:Nipbl UTSW 15 8,353,951 (GRCm39) missense probably benign 0.08
R2076:Nipbl UTSW 15 8,340,691 (GRCm39) missense probably benign 0.11
R2163:Nipbl UTSW 15 8,366,403 (GRCm39) missense probably damaging 0.99
R2170:Nipbl UTSW 15 8,322,702 (GRCm39) missense probably damaging 1.00
R2425:Nipbl UTSW 15 8,380,966 (GRCm39) missense probably benign 0.06
R2475:Nipbl UTSW 15 8,364,490 (GRCm39) missense probably benign 0.05
R2484:Nipbl UTSW 15 8,353,182 (GRCm39) missense probably damaging 0.99
R2970:Nipbl UTSW 15 8,340,723 (GRCm39) missense probably damaging 1.00
R3116:Nipbl UTSW 15 8,373,076 (GRCm39) missense probably benign 0.00
R3620:Nipbl UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R3725:Nipbl UTSW 15 8,325,145 (GRCm39) missense probably damaging 0.97
R3745:Nipbl UTSW 15 8,388,358 (GRCm39) missense probably benign
R3902:Nipbl UTSW 15 8,379,730 (GRCm39) missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8,380,018 (GRCm39) missense probably benign
R4164:Nipbl UTSW 15 8,368,418 (GRCm39) missense probably benign 0.24
R4246:Nipbl UTSW 15 8,361,916 (GRCm39) missense probably damaging 1.00
R4381:Nipbl UTSW 15 8,388,690 (GRCm39) missense probably benign 0.00
R4394:Nipbl UTSW 15 8,391,345 (GRCm39) missense probably benign 0.00
R4439:Nipbl UTSW 15 8,368,208 (GRCm39) missense probably damaging 0.98
R4440:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4441:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4672:Nipbl UTSW 15 8,332,468 (GRCm39) missense probably damaging 1.00
R4749:Nipbl UTSW 15 8,395,313 (GRCm39) missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8,380,981 (GRCm39) missense probably benign
R5428:Nipbl UTSW 15 8,359,780 (GRCm39) missense probably benign 0.00
R5641:Nipbl UTSW 15 8,396,196 (GRCm39) missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5644:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5681:Nipbl UTSW 15 8,330,866 (GRCm39) missense probably benign 0.22
R5899:Nipbl UTSW 15 8,364,328 (GRCm39) splice site probably null
R5970:Nipbl UTSW 15 8,326,302 (GRCm39) missense probably benign 0.27
R6041:Nipbl UTSW 15 8,353,748 (GRCm39) missense probably damaging 1.00
R6059:Nipbl UTSW 15 8,325,052 (GRCm39) missense probably damaging 1.00
R6213:Nipbl UTSW 15 8,364,390 (GRCm39) missense probably damaging 1.00
R6216:Nipbl UTSW 15 8,347,867 (GRCm39) missense probably damaging 0.99
R6236:Nipbl UTSW 15 8,354,064 (GRCm39) missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R6427:Nipbl UTSW 15 8,381,049 (GRCm39) missense probably benign
R6707:Nipbl UTSW 15 8,354,043 (GRCm39) missense probably benign 0.01
R6731:Nipbl UTSW 15 8,352,074 (GRCm39) missense probably damaging 1.00
R6921:Nipbl UTSW 15 8,332,969 (GRCm39) missense probably benign 0.28
R7239:Nipbl UTSW 15 8,321,619 (GRCm39) critical splice donor site probably null
R7346:Nipbl UTSW 15 8,373,090 (GRCm39) missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8,359,779 (GRCm39) missense probably benign 0.01
R7486:Nipbl UTSW 15 8,325,120 (GRCm39) missense probably benign 0.25
R7598:Nipbl UTSW 15 8,372,977 (GRCm39) missense probably benign 0.24
R7609:Nipbl UTSW 15 8,335,356 (GRCm39) missense probably benign 0.27
R7674:Nipbl UTSW 15 8,322,585 (GRCm39) missense probably benign 0.15
R7706:Nipbl UTSW 15 8,381,010 (GRCm39) missense probably benign 0.01
R7760:Nipbl UTSW 15 8,388,186 (GRCm39) missense probably damaging 1.00
R7766:Nipbl UTSW 15 8,326,333 (GRCm39) missense probably benign 0.45
R7825:Nipbl UTSW 15 8,320,971 (GRCm39) missense probably damaging 1.00
R7862:Nipbl UTSW 15 8,355,236 (GRCm39) missense probably benign 0.06
R7958:Nipbl UTSW 15 8,340,742 (GRCm39) missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8,340,734 (GRCm39) missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8,388,696 (GRCm39) missense probably benign 0.22
R8355:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8441:Nipbl UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R8455:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8717:Nipbl UTSW 15 8,368,225 (GRCm39) missense probably benign
R8739:Nipbl UTSW 15 8,332,904 (GRCm39) missense probably benign 0.08
R8854:Nipbl UTSW 15 8,330,210 (GRCm39) missense probably damaging 1.00
R8887:Nipbl UTSW 15 8,391,271 (GRCm39) missense probably damaging 1.00
R8942:Nipbl UTSW 15 8,381,104 (GRCm39) missense probably benign
R8991:Nipbl UTSW 15 8,320,997 (GRCm39) missense probably damaging 1.00
R9008:Nipbl UTSW 15 8,356,608 (GRCm39) missense probably damaging 1.00
R9070:Nipbl UTSW 15 8,368,215 (GRCm39) missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8,380,340 (GRCm39) missense probably benign 0.00
R9622:Nipbl UTSW 15 8,366,373 (GRCm39) missense probably benign 0.27
R9778:Nipbl UTSW 15 8,321,032 (GRCm39) missense probably benign 0.10
RF020:Nipbl UTSW 15 8,388,418 (GRCm39) missense probably damaging 0.98
X0022:Nipbl UTSW 15 8,381,199 (GRCm39) missense probably benign 0.05
X0027:Nipbl UTSW 15 8,353,021 (GRCm39) missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8,337,366 (GRCm39) missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8,368,183 (GRCm39) missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8,368,164 (GRCm39) critical splice donor site probably null
Z1177:Nipbl UTSW 15 8,366,436 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAACTGAGAAGGTGTG -3'
(R):5'- CCTCAAGTAGCTGATAGTACTAGTC -3'

Sequencing Primer
(F):5'- ACTGAGAAGGTGTGGTTTTGATAATG -3'
(R):5'- GCTTCTTTCTGATAGAGGCT -3'
Posted On 2016-11-21