Mutagenetix > Incidental Mutations

Incidental Mutation 'R5741:Asah2'

444820

Institutional Source

Beutler Lab

Gene Symbol

Asah2

Ensembl Gene

ENSMUSG00000024887

Gene Name

N-acylsphingosine amidohydrolase 2

Synonyms

neutral/alkaline ceramidase

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R5741 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31984654-32061469 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32008615 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 552 (Y552H)

Ref Sequence

ENSEMBL: ENSMUSP00000093830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096119]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096119
AA Change: Y552H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: Y552H

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	56	67	N/A	INTRINSIC
Pfam:Ceramidase_alk	78	584	1.4e-222	PFAM
Pfam:Ceramidse_alk_C	586	753	8e-50	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810010H24Rik	T	G	11: 107,028,489	F220C	probably damaging	Het
4932443I19Rik	A	T	8: 13,734,835	Q32L	possibly damaging	Het
Acox3	C	T	5: 35,608,324	H140Y	probably benign	Het
Ano3	A	T	2: 110,658,273	I938K	probably benign	Het
Ap3m1	A	C	14: 21,045,720	I14S	possibly damaging	Het
Arg1	T	C	10: 24,917,999	T127A	probably benign	Het
Chst12	A	G	5: 140,523,933	N105S	probably benign	Het
Cped1	G	A	6: 22,123,621	V458I	probably benign	Het
Cyld	T	G	8: 88,744,846	I786S	probably damaging	Het
Cyp2j8	C	T	4: 96,444,643	V489I	probably benign	Het
Dlgap4	T	C	2: 156,711,048	Y462H	probably damaging	Het
Dnah5	C	A	15: 28,246,367	A617D	probably benign	Het
Erc2	T	A	14: 28,302,869		probably null	Het
Fancm	A	G	12: 65,101,615	N668S	probably benign	Het
Gm5592	A	G	7: 41,289,201	I636V	probably benign	Het
Gtf2h2	A	T	13: 100,480,558	C247S	probably benign	Het
Hyal5	T	A	6: 24,876,495	H122Q	probably damaging	Het
Ints10	G	A	8: 68,804,922	R258K	probably damaging	Het
Kir3dl1	G	A	X: 136,526,482	D56N	probably damaging	Het
Lrguk	T	A	6: 34,048,867	D199E	probably damaging	Het
Lyst	A	G	13: 13,634,030	D95G	probably benign	Het
Map2k1	A	T	9: 64,214,601	L30Q	possibly damaging	Het
Nell1	G	A	7: 50,560,890		probably null	Het
Nfatc3	T	A	8: 106,079,066	I181N	probably damaging	Het
Nipbl	T	C	15: 8,324,649	K1668R	possibly damaging	Het
Olfr1467	A	G	19: 13,365,483	N285S	probably damaging	Het
Olfr862	A	G	9: 19,883,561	V248A	possibly damaging	Het
Olfr924	T	A	9: 38,848,603	L163*	probably null	Het
Otud7b	C	T	3: 96,144,304	T189I	probably damaging	Het
Pkia	A	T	3: 7,442,045	E62D	probably benign	Het
Plcb3	G	A	19: 6,954,422	Q1154*	probably null	Het
Pole4	T	C	6: 82,651,466	E105G	probably damaging	Het
Ppp1r3a	A	G	6: 14,719,883	V344A	probably damaging	Het
Ptpn21	A	T	12: 98,679,289	L1130Q	probably damaging	Het
Rapgef5	A	G	12: 117,756,029	D564G	probably damaging	Het
Samhd1	C	T	2: 157,112,831	R387H	probably benign	Het
Spag1	A	G	15: 36,183,703	K65E	possibly damaging	Het
Spata31d1d	A	T	13: 59,728,686	V345D	possibly damaging	Het
Spin1	G	A	13: 51,149,135	V255I	possibly damaging	Het
Tmem171	A	G	13: 98,692,051	V197A	probably benign	Het
Tmigd1	T	C	11: 76,907,090	V86A	possibly damaging	Het
Ttn	T	C	2: 76,712,073	D31777G	probably damaging	Het
Tymp	T	A	15: 89,376,436	M60L	probably benign	Het
Ugdh	T	C	5: 65,427,523	T19A	probably damaging	Het
Vmn1r234	G	T	17: 21,229,469	C215F	probably benign	Het
Wnt5b	T	C	6: 119,433,729	D250G	probably damaging	Het
Xrn1	T	A	9: 96,045,551	C1463S	probably benign	Het
Zfp831	T	A	2: 174,645,152	I540N	possibly damaging	Het
Zmynd8	T	C	2: 165,840,017	D189G	probably damaging	Het

Other mutations in Asah2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01108:Asah2	APN	19	32008681	splice site	probably benign
IGL02001:Asah2	APN	19	32043539	nonsense	probably null
IGL02228:Asah2	APN	19	32016714	missense	probably benign	0.09
IGL02377:Asah2	APN	19	32009414	missense	probably benign	0.30
IGL03070:Asah2	APN	19	32006344	missense	probably damaging	1.00
IGL03233:Asah2	APN	19	32054631	missense	probably benign	0.18
IGL03244:Asah2	APN	19	31986942	missense	probably damaging	1.00
R0008:Asah2	UTSW	19	32003731	nonsense	probably null
R0103:Asah2	UTSW	19	32018977	missense	probably benign	0.01
R0103:Asah2	UTSW	19	32018977	missense	probably benign	0.01
R0302:Asah2	UTSW	19	32052956	missense	probably benign	0.01
R0497:Asah2	UTSW	19	32054631	missense	probably benign	0.18
R0614:Asah2	UTSW	19	32016728	missense	probably damaging	1.00
R0639:Asah2	UTSW	19	32008639	missense	probably damaging	0.99
R0715:Asah2	UTSW	19	32016776	missense	probably damaging	0.97
R1332:Asah2	UTSW	19	32044941	missense	probably damaging	1.00
R1336:Asah2	UTSW	19	32044941	missense	probably damaging	1.00
R2045:Asah2	UTSW	19	32052956	missense	probably benign	0.01
R2062:Asah2	UTSW	19	32024874	missense	probably damaging	0.99
R4083:Asah2	UTSW	19	31986784	missense	probably benign	0.01
R4698:Asah2	UTSW	19	32054471	splice site	probably null
R4731:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R4732:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R4733:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R4773:Asah2	UTSW	19	32052858	missense	probably damaging	1.00
R4930:Asah2	UTSW	19	32052906	missense	probably benign	0.35
R5081:Asah2	UTSW	19	32014308	missense	probably benign	0.07
R5873:Asah2	UTSW	19	32003682	critical splice donor site	probably null
R5905:Asah2	UTSW	19	32016514	missense	probably damaging	1.00
R6027:Asah2	UTSW	19	32044951	missense	probably benign	0.01
R6028:Asah2	UTSW	19	32016514	missense	probably damaging	1.00
R6187:Asah2	UTSW	19	32024867	missense	probably damaging	0.99
R6667:Asah2	UTSW	19	31995358	missense	probably benign	0.41
R6968:Asah2	UTSW	19	32012513	missense	probably benign
R7010:Asah2	UTSW	19	32054554	missense	probably benign	0.00
R7404:Asah2	UTSW	19	32057854	missense	probably benign	0.13
R7575:Asah2	UTSW	19	32016703	missense	probably benign	0.11
R7797:Asah2	UTSW	19	32022361	missense	probably damaging	1.00
R8492:Asah2	UTSW	19	32006259	missense	probably benign	0.25
R8682:Asah2	UTSW	19	32052877	missense	probably damaging	1.00
R8766:Asah2	UTSW	19	32057880	missense	possibly damaging	0.46
R8873:Asah2	UTSW	19	32044888	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TACATGGAAGTGATGAACCCC -3'
(R):5'- ACACTTTCACATTCCTTGGTGG -3'

Sequencing Primer
(F):5'- TGGAAGTGATGAACCCCAAGCC -3'
(R):5'- TCATTGGGAAGATTTTTCTTAAGAGG -3'

Posted On

2016-11-21