Incidental Mutation 'R5741:Asah2'
ID444820
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene NameN-acylsphingosine amidohydrolase 2
Synonymsneutral/alkaline ceramidase
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R5741 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location31984654-32061469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32008615 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 552 (Y552H)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
Predicted Effect probably damaging
Transcript: ENSMUST00000096119
AA Change: Y552H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: Y552H

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 107,028,489 F220C probably damaging Het
4932443I19Rik A T 8: 13,734,835 Q32L possibly damaging Het
Acox3 C T 5: 35,608,324 H140Y probably benign Het
Ano3 A T 2: 110,658,273 I938K probably benign Het
Ap3m1 A C 14: 21,045,720 I14S possibly damaging Het
Arg1 T C 10: 24,917,999 T127A probably benign Het
Chst12 A G 5: 140,523,933 N105S probably benign Het
Cped1 G A 6: 22,123,621 V458I probably benign Het
Cyld T G 8: 88,744,846 I786S probably damaging Het
Cyp2j8 C T 4: 96,444,643 V489I probably benign Het
Dlgap4 T C 2: 156,711,048 Y462H probably damaging Het
Dnah5 C A 15: 28,246,367 A617D probably benign Het
Erc2 T A 14: 28,302,869 probably null Het
Fancm A G 12: 65,101,615 N668S probably benign Het
Gm5592 A G 7: 41,289,201 I636V probably benign Het
Gtf2h2 A T 13: 100,480,558 C247S probably benign Het
Hyal5 T A 6: 24,876,495 H122Q probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrguk T A 6: 34,048,867 D199E probably damaging Het
Lyst A G 13: 13,634,030 D95G probably benign Het
Map2k1 A T 9: 64,214,601 L30Q possibly damaging Het
Nell1 G A 7: 50,560,890 probably null Het
Nfatc3 T A 8: 106,079,066 I181N probably damaging Het
Nipbl T C 15: 8,324,649 K1668R possibly damaging Het
Olfr1467 A G 19: 13,365,483 N285S probably damaging Het
Olfr862 A G 9: 19,883,561 V248A possibly damaging Het
Olfr924 T A 9: 38,848,603 L163* probably null Het
Otud7b C T 3: 96,144,304 T189I probably damaging Het
Pkia A T 3: 7,442,045 E62D probably benign Het
Plcb3 G A 19: 6,954,422 Q1154* probably null Het
Pole4 T C 6: 82,651,466 E105G probably damaging Het
Ppp1r3a A G 6: 14,719,883 V344A probably damaging Het
Ptpn21 A T 12: 98,679,289 L1130Q probably damaging Het
Rapgef5 A G 12: 117,756,029 D564G probably damaging Het
Samhd1 C T 2: 157,112,831 R387H probably benign Het
Spag1 A G 15: 36,183,703 K65E possibly damaging Het
Spata31d1d A T 13: 59,728,686 V345D possibly damaging Het
Spin1 G A 13: 51,149,135 V255I possibly damaging Het
Tmem171 A G 13: 98,692,051 V197A probably benign Het
Tmigd1 T C 11: 76,907,090 V86A possibly damaging Het
Ttn T C 2: 76,712,073 D31777G probably damaging Het
Tymp T A 15: 89,376,436 M60L probably benign Het
Ugdh T C 5: 65,427,523 T19A probably damaging Het
Vmn1r234 G T 17: 21,229,469 C215F probably benign Het
Wnt5b T C 6: 119,433,729 D250G probably damaging Het
Xrn1 T A 9: 96,045,551 C1463S probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Zmynd8 T C 2: 165,840,017 D189G probably damaging Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 32008681 splice site probably benign
IGL02001:Asah2 APN 19 32043539 nonsense probably null
IGL02228:Asah2 APN 19 32016714 missense probably benign 0.09
IGL02377:Asah2 APN 19 32009414 missense probably benign 0.30
IGL03070:Asah2 APN 19 32006344 missense probably damaging 1.00
IGL03233:Asah2 APN 19 32054631 missense probably benign 0.18
IGL03244:Asah2 APN 19 31986942 missense probably damaging 1.00
R0008:Asah2 UTSW 19 32003731 nonsense probably null
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0302:Asah2 UTSW 19 32052956 missense probably benign 0.01
R0497:Asah2 UTSW 19 32054631 missense probably benign 0.18
R0614:Asah2 UTSW 19 32016728 missense probably damaging 1.00
R0639:Asah2 UTSW 19 32008639 missense probably damaging 0.99
R0715:Asah2 UTSW 19 32016776 missense probably damaging 0.97
R1332:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R1336:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R2045:Asah2 UTSW 19 32052956 missense probably benign 0.01
R2062:Asah2 UTSW 19 32024874 missense probably damaging 0.99
R4083:Asah2 UTSW 19 31986784 missense probably benign 0.01
R4698:Asah2 UTSW 19 32054471 splice site probably null
R4731:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4732:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4733:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4773:Asah2 UTSW 19 32052858 missense probably damaging 1.00
R4930:Asah2 UTSW 19 32052906 missense probably benign 0.35
R5081:Asah2 UTSW 19 32014308 missense probably benign 0.07
R5873:Asah2 UTSW 19 32003682 critical splice donor site probably null
R5905:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6027:Asah2 UTSW 19 32044951 missense probably benign 0.01
R6028:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6187:Asah2 UTSW 19 32024867 missense probably damaging 0.99
R6667:Asah2 UTSW 19 31995358 missense probably benign 0.41
R6968:Asah2 UTSW 19 32012513 missense probably benign
R7010:Asah2 UTSW 19 32054554 missense probably benign 0.00
R7404:Asah2 UTSW 19 32057854 missense probably benign 0.13
R7575:Asah2 UTSW 19 32016703 missense probably benign 0.11
R7797:Asah2 UTSW 19 32022361 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATGGAAGTGATGAACCCC -3'
(R):5'- ACACTTTCACATTCCTTGGTGG -3'

Sequencing Primer
(F):5'- TGGAAGTGATGAACCCCAAGCC -3'
(R):5'- TCATTGGGAAGATTTTTCTTAAGAGG -3'
Posted On2016-11-21