Incidental Mutation 'R5741:Kir3dl1'
ID444821
Institutional Source Beutler Lab
Gene Symbol Kir3dl1
Ensembl Gene ENSMUSG00000031424
Gene Namekiller cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1
SynonymsKirl1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5741 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location136517999-136534309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136526482 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 56 (D56N)
Ref Sequence ENSEMBL: ENSMUSP00000108728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113104] [ENSMUST00000113105] [ENSMUST00000113108]
Predicted Effect probably damaging
Transcript: ENSMUST00000113104
AA Change: D56N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108728
Gene: ENSMUSG00000031424
AA Change: D56N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 34 125 1.03e0 SMART
IG_like 137 222 1.28e2 SMART
low complexity region 245 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113105
AA Change: D149N

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108729
Gene: ENSMUSG00000031424
AA Change: D149N

DomainStartEndE-ValueType
IG 34 116 7.7e-5 SMART
IG 127 218 1.03e0 SMART
IG_like 230 315 1.28e2 SMART
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113108
SMART Domains Protein: ENSMUSP00000108732
Gene: ENSMUSG00000057439

DomainStartEndE-ValueType
IG 34 116 1.25e-4 SMART
IG 127 218 4.04e0 SMART
IG_like 230 315 1.06e2 SMART
transmembrane domain 338 360 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T G 11: 107,028,489 F220C probably damaging Het
4932443I19Rik A T 8: 13,734,835 Q32L possibly damaging Het
Acox3 C T 5: 35,608,324 H140Y probably benign Het
Ano3 A T 2: 110,658,273 I938K probably benign Het
Ap3m1 A C 14: 21,045,720 I14S possibly damaging Het
Arg1 T C 10: 24,917,999 T127A probably benign Het
Asah2 A G 19: 32,008,615 Y552H probably damaging Het
Chst12 A G 5: 140,523,933 N105S probably benign Het
Cped1 G A 6: 22,123,621 V458I probably benign Het
Cyld T G 8: 88,744,846 I786S probably damaging Het
Cyp2j8 C T 4: 96,444,643 V489I probably benign Het
Dlgap4 T C 2: 156,711,048 Y462H probably damaging Het
Dnah5 C A 15: 28,246,367 A617D probably benign Het
Erc2 T A 14: 28,302,869 probably null Het
Fancm A G 12: 65,101,615 N668S probably benign Het
Gm5592 A G 7: 41,289,201 I636V probably benign Het
Gtf2h2 A T 13: 100,480,558 C247S probably benign Het
Hyal5 T A 6: 24,876,495 H122Q probably damaging Het
Ints10 G A 8: 68,804,922 R258K probably damaging Het
Lrguk T A 6: 34,048,867 D199E probably damaging Het
Lyst A G 13: 13,634,030 D95G probably benign Het
Map2k1 A T 9: 64,214,601 L30Q possibly damaging Het
Nell1 G A 7: 50,560,890 probably null Het
Nfatc3 T A 8: 106,079,066 I181N probably damaging Het
Nipbl T C 15: 8,324,649 K1668R possibly damaging Het
Olfr1467 A G 19: 13,365,483 N285S probably damaging Het
Olfr862 A G 9: 19,883,561 V248A possibly damaging Het
Olfr924 T A 9: 38,848,603 L163* probably null Het
Otud7b C T 3: 96,144,304 T189I probably damaging Het
Pkia A T 3: 7,442,045 E62D probably benign Het
Plcb3 G A 19: 6,954,422 Q1154* probably null Het
Pole4 T C 6: 82,651,466 E105G probably damaging Het
Ppp1r3a A G 6: 14,719,883 V344A probably damaging Het
Ptpn21 A T 12: 98,679,289 L1130Q probably damaging Het
Rapgef5 A G 12: 117,756,029 D564G probably damaging Het
Samhd1 C T 2: 157,112,831 R387H probably benign Het
Spag1 A G 15: 36,183,703 K65E possibly damaging Het
Spata31d1d A T 13: 59,728,686 V345D possibly damaging Het
Spin1 G A 13: 51,149,135 V255I possibly damaging Het
Tmem171 A G 13: 98,692,051 V197A probably benign Het
Tmigd1 T C 11: 76,907,090 V86A possibly damaging Het
Ttn T C 2: 76,712,073 D31777G probably damaging Het
Tymp T A 15: 89,376,436 M60L probably benign Het
Ugdh T C 5: 65,427,523 T19A probably damaging Het
Vmn1r234 G T 17: 21,229,469 C215F probably benign Het
Wnt5b T C 6: 119,433,729 D250G probably damaging Het
Xrn1 T A 9: 96,045,551 C1463S probably benign Het
Zfp831 T A 2: 174,645,152 I540N possibly damaging Het
Zmynd8 T C 2: 165,840,017 D189G probably damaging Het
Other mutations in Kir3dl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Kir3dl1 APN X 136525162 missense probably damaging 1.00
IGL01137:Kir3dl1 APN X 136526611 missense probably damaging 1.00
R0626:Kir3dl1 UTSW X 136533845 splice site probably null
R2265:Kir3dl1 UTSW X 136525035 missense probably benign
R2268:Kir3dl1 UTSW X 136525035 missense probably benign
R5725:Kir3dl1 UTSW X 136526482 missense probably damaging 0.96
R5739:Kir3dl1 UTSW X 136526482 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACACAGGGTCAATGACAGG -3'
(R):5'- GATGTCAATGGGGTCACTGGAG -3'

Sequencing Primer
(F):5'- CACAGGGTCAATGACAGGGAAAAC -3'
(R):5'- CACTGGAGTCTGACCATTCATAGG -3'
Posted On2016-11-21