Mutagenetix > Incidental Mutations

Incidental Mutation 'R5752:Ints7'

444824

Institutional Source

Beutler Lab

Gene Symbol

Ints7

Ensembl Gene

ENSMUSG00000037461

Gene Name

integrator complex subunit 7

Synonyms

5930412E23Rik

MMRRC Submission

043357-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R5752 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

191575636-191623688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 191575893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 12 (D12E)

Ref Sequence

ENSEMBL: ENSMUSP00000036277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027933] [ENSMUST00000045450] [ENSMUST00000193569] [ENSMUST00000193977] [ENSMUST00000194785] [ENSMUST00000194877] [ENSMUST00000195650]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027933

SMART Domains

Protein: ENSMUSP00000027933
Gene: ENSMUSG00000037474

Domain	Start	End	E-Value	Type
Blast:WD40	30	80	1e-24	BLAST
WD40	87	126	2.61e-3	SMART
WD40	129	169	8.04e-4	SMART
WD40	205	244	8.29e-1	SMART
Blast:WD40	265	299	1e-11	BLAST
WD40	304	345	1.29e-2	SMART
WD40	349	389	1.07e-8	SMART
low complexity region	427	454	N/A	INTRINSIC
low complexity region	476	495	N/A	INTRINSIC
low complexity region	505	521	N/A	INTRINSIC
low complexity region	630	645	N/A	INTRINSIC
low complexity region	674	690	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000045450
AA Change: D12E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000036277
Gene: ENSMUSG00000037461
AA Change: D12E

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	76	530	1e-10	SMART
low complexity region	937	960	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192681

Predicted Effect

probably benign
Transcript: ENSMUST00000193569
AA Change: D12E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193961

Predicted Effect

probably benign
Transcript: ENSMUST00000193977

SMART Domains

Protein: ENSMUSP00000142111
Gene: ENSMUSG00000037474

Domain	Start	End	E-Value	Type
Blast:WD40	30	80	1e-26	BLAST
SCOP:d1e1aa_	65	108	6e-5	SMART
Blast:WD40	87	113	6e-13	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194064

Predicted Effect

unknown
Transcript: ENSMUST00000194785
AA Change: D12E

Predicted Effect

probably benign
Transcript: ENSMUST00000194877
AA Change: D12E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000195650

SMART Domains

Protein: ENSMUSP00000141218
Gene: ENSMUSG00000037474

Domain	Start	End	E-Value	Type
Blast:WD40	30	80	2e-26	BLAST
WD40	87	126	1.6e-5	SMART
Blast:WD40	129	154	7e-10	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195765

Meta Mutation Damage Score

0.0843

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the integrator complex. The integrator complex associates with the C-terminal domain of RNA polymerase II and mediates 3'-end processing of the small nuclear RNAs U1 and U2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,743,202	Y268C	probably damaging	Het
A330017A19Rik	C	A	17: 46,890,040		probably benign	Het
Aldh1l2	C	A	10: 83,520,380	G49C	probably damaging	Het
Arhgap26	G	A	18: 39,286,672	E11K	probably damaging	Het
Asns	C	T	6: 7,689,365	G46S	probably damaging	Het
Atrn	G	T	2: 130,906,544		probably benign	Het
C77080	GGTG	GGTGTG	4: 129,223,980		probably null	Het
Cep126	A	C	9: 8,120,745	Y92*	probably null	Het
Cfap69	T	C	5: 5,589,204	T567A	probably damaging	Het
Clgn	T	A	8: 83,397,041	Y61N	probably damaging	Het
Col28a1	T	G	6: 8,015,025	K793N	possibly damaging	Het
Cxcl9	C	A	5: 92,323,856	M108I	probably benign	Het
Cyp4f37	A	T	17: 32,631,332	I318F	probably damaging	Het
Daam1	T	C	12: 71,946,546	M363T	unknown	Het
Dnajc13	A	C	9: 104,192,774		probably null	Het
Entpd2	G	A	2: 25,399,769		probably benign	Het
F3	T	A	3: 121,732,404	N205K	probably damaging	Het
Fat2	A	T	11: 55,289,237	F1426Y	possibly damaging	Het
Galnt6	A	T	15: 100,704,126	F267I	probably damaging	Het
Gm1322	G	A	2: 67,184,635		noncoding transcript	Het
Gm6768	A	G	12: 119,262,614		noncoding transcript	Het
Gm960	C	A	19: 4,626,020	A695S	probably benign	Het
Hdgfl3	A	C	7: 81,899,703	S143A	possibly damaging	Het
Kank3	A	G	17: 33,818,063	T114A	probably benign	Het
Lrp1b	A	G	2: 41,295,612	Y1364H	probably damaging	Het
Mef2b	A	G	8: 70,165,617	T116A	possibly damaging	Het
Megf8	C	T	7: 25,355,114	T1885I	probably damaging	Het
Mrps11	A	G	7: 78,783,595	K30E	probably benign	Het
Naca	T	A	10: 128,041,928		probably benign	Het
Olfr521	T	C	7: 99,767,948	I262T	probably benign	Het
Paip2b	C	T	6: 83,831,270		probably null	Het
Plcb2	G	T	2: 118,711,051		probably benign	Het
Plcd4	A	G	1: 74,547,972		probably null	Het
Pnpla8	A	G	12: 44,282,887	N74S	probably benign	Het
Pot1b	A	T	17: 55,687,834	I276N	probably damaging	Het
Qprt	C	T	7: 127,109,244	G5D	probably benign	Het
Rab11fip1	T	C	8: 27,156,586	N154S	probably damaging	Het
Rin3	G	A	12: 102,313,119		probably benign	Het
Sdf4	C	T	4: 155,996,304	P37S	probably damaging	Het
Selp	A	T	1: 164,137,242	D491V	probably damaging	Het
Sh3gl3	A	G	7: 82,174,948		probably benign	Het
Sp110	G	C	1: 85,577,202		probably benign	Het
Tas2r134	A	G	2: 51,627,868	R120G	probably damaging	Het
Tgfbr3	T	C	5: 107,139,807	R509G	probably benign	Het
Tle3	T	A	9: 61,407,471	Y231N	probably damaging	Het
Ttc41	C	T	10: 86,758,346	T881I	probably benign	Het
Ttll8	T	C	15: 88,932,728	Y271C	probably benign	Het
Ttn	A	T	2: 76,947,984	I1307K	possibly damaging	Het
Ube2k	A	G	5: 65,566,068	D48G	probably damaging	Het
Vcan	T	C	13: 89,679,950	T3126A	probably damaging	Het
Vps13d	T	C	4: 145,148,970	T1656A	probably benign	Het
Zzz3	C	A	3: 152,452,122	S777R	possibly damaging	Het

Other mutations in Ints7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ints7	APN	1	191596164	splice site	probably null
IGL01285:Ints7	APN	1	191615778	missense	probably benign	0.00
IGL01289:Ints7	APN	1	191615778	missense	probably benign	0.00
IGL01572:Ints7	APN	1	191615793	missense	possibly damaging	0.71
IGL01665:Ints7	APN	1	191613219	splice site	probably benign
IGL02059:Ints7	APN	1	191615760	missense	probably benign	0.23
IGL02684:Ints7	APN	1	191613637	critical splice acceptor site	probably null
IGL02686:Ints7	APN	1	191586592	missense	probably damaging	1.00
IGL02812:Ints7	APN	1	191619741	missense	probably damaging	1.00
IGL03119:Ints7	APN	1	191610365	missense	probably damaging	1.00
IGL03162:Ints7	APN	1	191621412	utr 3 prime	probably benign
PIT4810001:Ints7	UTSW	1	191596236	missense	probably damaging	0.99
R0294:Ints7	UTSW	1	191611891	missense	possibly damaging	0.91
R0479:Ints7	UTSW	1	191614554	splice site	probably null
R0698:Ints7	UTSW	1	191594464	missense	probably damaging	0.97
R1420:Ints7	UTSW	1	191613057	missense	possibly damaging	0.73
R1680:Ints7	UTSW	1	191621162	splice site	probably null
R1781:Ints7	UTSW	1	191596284	missense	possibly damaging	0.95
R2141:Ints7	UTSW	1	191604860	missense	possibly damaging	0.73
R2291:Ints7	UTSW	1	191606203	splice site	probably null
R4718:Ints7	UTSW	1	191583277	missense	possibly damaging	0.60
R4741:Ints7	UTSW	1	191619635	missense	probably benign	0.29
R4797:Ints7	UTSW	1	191596933	missense	probably damaging	1.00
R4812:Ints7	UTSW	1	191594430	missense	possibly damaging	0.73
R4826:Ints7	UTSW	1	191611906	missense	probably damaging	0.97
R4870:Ints7	UTSW	1	191596331	missense	probably damaging	0.97
R5169:Ints7	UTSW	1	191613090	missense	probably benign	0.00
R5281:Ints7	UTSW	1	191615771	missense	possibly damaging	0.90
R5694:Ints7	UTSW	1	191586618	missense	probably damaging	1.00
R6048:Ints7	UTSW	1	191621412	utr 3 prime	probably benign
R6341:Ints7	UTSW	1	191613127	missense	probably damaging	1.00
R6419:Ints7	UTSW	1	191602302	missense	possibly damaging	0.69
R7037:Ints7	UTSW	1	191619605	missense	probably benign	0.16
R7163:Ints7	UTSW	1	191617837	missense	possibly damaging	0.67
R7603:Ints7	UTSW	1	191596224	missense	probably damaging	1.00
R7801:Ints7	UTSW	1	191615747	missense	possibly damaging	0.84
R7899:Ints7	UTSW	1	191621315	missense	probably damaging	1.00
R8034:Ints7	UTSW	1	191613068	frame shift	probably null
R8034:Ints7	UTSW	1	191613071	frame shift	probably null
R8231:Ints7	UTSW	1	191596353	nonsense	probably null
R8251:Ints7	UTSW	1	191621433	missense	unknown
R8520:Ints7	UTSW	1	191582491	missense	probably damaging	1.00
R8966:Ints7	UTSW	1	191619605	missense	probably benign	0.16
R9198:Ints7	UTSW	1	191619760	missense	probably benign	0.42
R9382:Ints7	UTSW	1	191619681	missense	probably damaging	1.00
Z1177:Ints7	UTSW	1	191610458	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AACCCAAGGTTCACAGGCTC -3'
(R):5'- CTCCAACTGTGCAAGGCTAC -3'

Sequencing Primer
(F):5'- CCAGAGAGGAACTGGCGAACC -3'
(R):5'- ACTGTGCAAGGCTACTCCAG -3'

Posted On

2016-11-21