Incidental Mutation 'R5752:Tas2r134'
ID444827
Institutional Source Beutler Lab
Gene Symbol Tas2r134
Ensembl Gene ENSMUSG00000056115
Gene Nametaste receptor, type 2, member 134
SynonymsT2R134, Tas2r34
MMRRC Submission 043357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R5752 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location51627511-51628408 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51627868 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 120 (R120G)
Ref Sequence ENSEMBL: ENSMUSP00000064657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070028]
Predicted Effect probably damaging
Transcript: ENSMUST00000070028
AA Change: R120G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064657
Gene: ENSMUSG00000056115
AA Change: R120G

DomainStartEndE-ValueType
Pfam:TAS2R 1 291 1.4e-75 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,202 Y268C probably damaging Het
A330017A19Rik C A 17: 46,890,040 probably benign Het
Aldh1l2 C A 10: 83,520,380 G49C probably damaging Het
Arhgap26 G A 18: 39,286,672 E11K probably damaging Het
Asns C T 6: 7,689,365 G46S probably damaging Het
Atrn G T 2: 130,906,544 probably benign Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cep126 A C 9: 8,120,745 Y92* probably null Het
Cfap69 T C 5: 5,589,204 T567A probably damaging Het
Clgn T A 8: 83,397,041 Y61N probably damaging Het
Col28a1 T G 6: 8,015,025 K793N possibly damaging Het
Cxcl9 C A 5: 92,323,856 M108I probably benign Het
Cyp4f37 A T 17: 32,631,332 I318F probably damaging Het
Daam1 T C 12: 71,946,546 M363T unknown Het
Dnajc13 A C 9: 104,192,774 probably null Het
Entpd2 G A 2: 25,399,769 probably benign Het
F3 T A 3: 121,732,404 N205K probably damaging Het
Fat2 A T 11: 55,289,237 F1426Y possibly damaging Het
Galnt6 A T 15: 100,704,126 F267I probably damaging Het
Gm1322 G A 2: 67,184,635 noncoding transcript Het
Gm6768 A G 12: 119,262,614 noncoding transcript Het
Gm960 C A 19: 4,626,020 A695S probably benign Het
Hdgfl3 A C 7: 81,899,703 S143A possibly damaging Het
Ints7 T A 1: 191,575,893 D12E probably benign Het
Kank3 A G 17: 33,818,063 T114A probably benign Het
Lrp1b A G 2: 41,295,612 Y1364H probably damaging Het
Mef2b A G 8: 70,165,617 T116A possibly damaging Het
Megf8 C T 7: 25,355,114 T1885I probably damaging Het
Mrps11 A G 7: 78,783,595 K30E probably benign Het
Naca T A 10: 128,041,928 probably benign Het
Olfr521 T C 7: 99,767,948 I262T probably benign Het
Paip2b C T 6: 83,831,270 probably null Het
Plcb2 G T 2: 118,711,051 probably benign Het
Plcd4 A G 1: 74,547,972 probably null Het
Pnpla8 A G 12: 44,282,887 N74S probably benign Het
Pot1b A T 17: 55,687,834 I276N probably damaging Het
Qprt C T 7: 127,109,244 G5D probably benign Het
Rab11fip1 T C 8: 27,156,586 N154S probably damaging Het
Rin3 G A 12: 102,313,119 probably benign Het
Sdf4 C T 4: 155,996,304 P37S probably damaging Het
Selp A T 1: 164,137,242 D491V probably damaging Het
Sh3gl3 A G 7: 82,174,948 probably benign Het
Sp110 G C 1: 85,577,202 probably benign Het
Tgfbr3 T C 5: 107,139,807 R509G probably benign Het
Tle3 T A 9: 61,407,471 Y231N probably damaging Het
Ttc41 C T 10: 86,758,346 T881I probably benign Het
Ttll8 T C 15: 88,932,728 Y271C probably benign Het
Ttn A T 2: 76,947,984 I1307K possibly damaging Het
Ube2k A G 5: 65,566,068 D48G probably damaging Het
Vcan T C 13: 89,679,950 T3126A probably damaging Het
Vps13d T C 4: 145,148,970 T1656A probably benign Het
Zzz3 C A 3: 152,452,122 S777R possibly damaging Het
Other mutations in Tas2r134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL00563:Tas2r134 APN 2 51628088 missense possibly damaging 0.90
IGL01121:Tas2r134 APN 2 51627989 missense probably damaging 1.00
IGL01122:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01128:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01132:Tas2r134 APN 2 51627659 missense probably damaging 1.00
IGL01312:Tas2r134 APN 2 51628235 missense probably damaging 1.00
IGL01419:Tas2r134 APN 2 51627747 nonsense probably null
IGL01774:Tas2r134 APN 2 51628148 missense probably benign 0.07
IGL02735:Tas2r134 APN 2 51627827 missense probably damaging 1.00
R0799:Tas2r134 UTSW 2 51628373 missense probably benign 0.00
R1205:Tas2r134 UTSW 2 51627986 missense probably benign 0.00
R2267:Tas2r134 UTSW 2 51628237 missense probably benign 0.01
R3736:Tas2r134 UTSW 2 51627774 missense probably damaging 1.00
R5254:Tas2r134 UTSW 2 51627547 missense probably benign 0.39
R6162:Tas2r134 UTSW 2 51627559 missense probably damaging 1.00
R6940:Tas2r134 UTSW 2 51628136 missense probably benign 0.00
R6954:Tas2r134 UTSW 2 51627770 missense probably benign 0.00
R6996:Tas2r134 UTSW 2 51627589 missense probably benign 0.00
R7206:Tas2r134 UTSW 2 51628108 missense probably benign 0.02
R7303:Tas2r134 UTSW 2 51628133 missense probably benign 0.01
R7348:Tas2r134 UTSW 2 51628402 missense possibly damaging 0.92
R7479:Tas2r134 UTSW 2 51627529 missense not run
R7575:Tas2r134 UTSW 2 51628154 missense probably damaging 1.00
R7686:Tas2r134 UTSW 2 51628243 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CAGGTGACATGATTATGGCTTGC -3'
(R):5'- ACATCAGCATCGCATGACAG -3'

Sequencing Primer
(F):5'- TCTGCATGGAATAGCCGTC -3'
(R):5'- AGCGAAAATAATACAGATAGAATGCC -3'
Posted On2016-11-21