Incidental Mutation 'H8786:Pik3c3'
ID44484
Institutional Source Beutler Lab
Gene Symbol Pik3c3
Ensembl Gene ENSMUSG00000033628
Gene Namephosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms5330434F23Rik, Vps34
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #H8786 (G3) of strain 617
Quality Score152
Status Not validated
Chromosome18
Chromosomal Location30272747-30348126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30294343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 300 (V300A)
Ref Sequence ENSEMBL: ENSMUSP00000128927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091978] [ENSMUST00000115811] [ENSMUST00000115812] [ENSMUST00000131405]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091978
AA Change: V300A

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000089601
Gene: ENSMUSG00000033628
AA Change: V300A

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 848 1.02e-84 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115811
AA Change: V300A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111478
Gene: ENSMUSG00000033628
AA Change: V300A

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 756 5.33e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115812
AA Change: V300A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111479
Gene: ENSMUSG00000033628
AA Change: V300A

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 884 1.21e-118 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131405
AA Change: V300A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128927
Gene: ENSMUSG00000033628
AA Change: V300A

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 506 1.78e-84 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality between implantation and placentation, arrest prior to gastrulation, and show reduced cell proliferation. Mice homozygous for a conditional allele activated in T cells exhibit impaired naive Tcell homeostasis and mitophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Pik3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pik3c3 APN 18 30303078 splice site probably benign
IGL00743:Pik3c3 APN 18 30274364 missense probably damaging 1.00
IGL01622:Pik3c3 APN 18 30290525 nonsense probably null
IGL01622:Pik3c3 APN 18 30293049 splice site probably benign
IGL01623:Pik3c3 APN 18 30290525 nonsense probably null
IGL01623:Pik3c3 APN 18 30293049 splice site probably benign
IGL01773:Pik3c3 APN 18 30277102 missense probably damaging 1.00
IGL01917:Pik3c3 APN 18 30274446 missense probably damaging 1.00
IGL02033:Pik3c3 APN 18 30312650 missense possibly damaging 0.85
IGL02465:Pik3c3 APN 18 30344060 missense probably damaging 0.97
IGL03161:Pik3c3 APN 18 30293707 missense probably benign 0.37
IGL03221:Pik3c3 APN 18 30302931 missense probably benign 0.45
R0089:Pik3c3 UTSW 18 30303078 splice site probably benign
R1512:Pik3c3 UTSW 18 30322236 critical splice donor site probably null
R1713:Pik3c3 UTSW 18 30323586 missense possibly damaging 0.73
R1758:Pik3c3 UTSW 18 30277010 missense probably damaging 1.00
R1822:Pik3c3 UTSW 18 30344077 critical splice donor site probably null
R1870:Pik3c3 UTSW 18 30293132 critical splice donor site probably null
R2680:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R3768:Pik3c3 UTSW 18 30333273 missense probably damaging 1.00
R3926:Pik3c3 UTSW 18 30311329 splice site probably benign
R4154:Pik3c3 UTSW 18 30311283 missense probably benign 0.35
R4293:Pik3c3 UTSW 18 30343990 missense probably damaging 1.00
R4570:Pik3c3 UTSW 18 30290550 missense possibly damaging 0.94
R4858:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R4893:Pik3c3 UTSW 18 30282000 missense probably benign 0.16
R4901:Pik3c3 UTSW 18 30302929 missense possibly damaging 0.65
R5216:Pik3c3 UTSW 18 30272976 missense probably damaging 1.00
R5358:Pik3c3 UTSW 18 30323544 missense probably damaging 1.00
R5373:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5374:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5600:Pik3c3 UTSW 18 30311293 missense probably damaging 1.00
R5680:Pik3c3 UTSW 18 30277113 nonsense probably null
R5965:Pik3c3 UTSW 18 30298580 missense probably damaging 1.00
R6492:Pik3c3 UTSW 18 30324562 missense probably damaging 1.00
R6576:Pik3c3 UTSW 18 30342741 intron probably benign
R6700:Pik3c3 UTSW 18 30316901 missense probably benign 0.02
R7523:Pik3c3 UTSW 18 30293655 missense probably damaging 1.00
R7883:Pik3c3 UTSW 18 30274363 missense probably benign 0.04
R7884:Pik3c3 UTSW 18 30312571 missense probably benign 0.00
R7886:Pik3c3 UTSW 18 30319588 nonsense probably null
R7966:Pik3c3 UTSW 18 30274363 missense probably benign 0.04
R7967:Pik3c3 UTSW 18 30312571 missense probably benign 0.00
R7969:Pik3c3 UTSW 18 30319588 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGACATTGCCACTTTGGCTTCC -3'
(R):5'- TCCAGAATGCCAAGCTGTCTCCAC -3'

Sequencing Primer
(F):5'- GTTCCTTCAATGTCCTAATGAGTTG -3'
(R):5'- TGTAGCAAGACTGCTTGACC -3'
Posted On2013-06-11