Incidental Mutation 'R5752:Olfr521'
ID444849
Institutional Source Beutler Lab
Gene Symbol Olfr521
Ensembl Gene ENSMUSG00000073997
Gene Nameolfactory receptor 521
SynonymsMOR101-2, GA_x6K02T2PBJ9-2443810-2444775
MMRRC Submission 043357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5752 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location99763507-99769321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99767948 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 262 (I262T)
Ref Sequence ENSEMBL: ENSMUSP00000151473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098263] [ENSMUST00000219663] [ENSMUST00000220001]
Predicted Effect probably benign
Transcript: ENSMUST00000098263
AA Change: I262T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000095863
Gene: ENSMUSG00000073997
AA Change: I262T

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.4e-63 PFAM
Pfam:7TM_GPCR_Srsx 40 310 7.4e-6 PFAM
Pfam:7tm_1 46 309 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219663
AA Change: I262T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000220001
AA Change: I262T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,202 Y268C probably damaging Het
A330017A19Rik C A 17: 46,890,040 probably benign Het
Aldh1l2 C A 10: 83,520,380 G49C probably damaging Het
Arhgap26 G A 18: 39,286,672 E11K probably damaging Het
Asns C T 6: 7,689,365 G46S probably damaging Het
Atrn G T 2: 130,906,544 probably benign Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cep126 A C 9: 8,120,745 Y92* probably null Het
Cfap69 T C 5: 5,589,204 T567A probably damaging Het
Clgn T A 8: 83,397,041 Y61N probably damaging Het
Col28a1 T G 6: 8,015,025 K793N possibly damaging Het
Cxcl9 C A 5: 92,323,856 M108I probably benign Het
Cyp4f37 A T 17: 32,631,332 I318F probably damaging Het
Daam1 T C 12: 71,946,546 M363T unknown Het
Dnajc13 A C 9: 104,192,774 probably null Het
Entpd2 G A 2: 25,399,769 probably benign Het
F3 T A 3: 121,732,404 N205K probably damaging Het
Fat2 A T 11: 55,289,237 F1426Y possibly damaging Het
Galnt6 A T 15: 100,704,126 F267I probably damaging Het
Gm1322 G A 2: 67,184,635 noncoding transcript Het
Gm6768 A G 12: 119,262,614 noncoding transcript Het
Gm960 C A 19: 4,626,020 A695S probably benign Het
Hdgfl3 A C 7: 81,899,703 S143A possibly damaging Het
Ints7 T A 1: 191,575,893 D12E probably benign Het
Kank3 A G 17: 33,818,063 T114A probably benign Het
Lrp1b A G 2: 41,295,612 Y1364H probably damaging Het
Mef2b A G 8: 70,165,617 T116A possibly damaging Het
Megf8 C T 7: 25,355,114 T1885I probably damaging Het
Mrps11 A G 7: 78,783,595 K30E probably benign Het
Naca T A 10: 128,041,928 probably benign Het
Paip2b C T 6: 83,831,270 probably null Het
Plcb2 G T 2: 118,711,051 probably benign Het
Plcd4 A G 1: 74,547,972 probably null Het
Pnpla8 A G 12: 44,282,887 N74S probably benign Het
Pot1b A T 17: 55,687,834 I276N probably damaging Het
Qprt C T 7: 127,109,244 G5D probably benign Het
Rab11fip1 T C 8: 27,156,586 N154S probably damaging Het
Rin3 G A 12: 102,313,119 probably benign Het
Sdf4 C T 4: 155,996,304 P37S probably damaging Het
Selp A T 1: 164,137,242 D491V probably damaging Het
Sh3gl3 A G 7: 82,174,948 probably benign Het
Sp110 G C 1: 85,577,202 probably benign Het
Tas2r134 A G 2: 51,627,868 R120G probably damaging Het
Tgfbr3 T C 5: 107,139,807 R509G probably benign Het
Tle3 T A 9: 61,407,471 Y231N probably damaging Het
Ttc41 C T 10: 86,758,346 T881I probably benign Het
Ttll8 T C 15: 88,932,728 Y271C probably benign Het
Ttn A T 2: 76,947,984 I1307K possibly damaging Het
Ube2k A G 5: 65,566,068 D48G probably damaging Het
Vcan T C 13: 89,679,950 T3126A probably damaging Het
Vps13d T C 4: 145,148,970 T1656A probably benign Het
Zzz3 C A 3: 152,452,122 S777R possibly damaging Het
Other mutations in Olfr521
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02303:Olfr521 APN 7 99767972 missense possibly damaging 0.73
IGL02491:Olfr521 APN 7 99767333 missense possibly damaging 0.85
BB007:Olfr521 UTSW 7 99767596 missense probably benign 0.37
BB017:Olfr521 UTSW 7 99767596 missense probably benign 0.37
R0544:Olfr521 UTSW 7 99767660 missense probably benign
R1029:Olfr521 UTSW 7 99767224 missense probably benign 0.01
R1840:Olfr521 UTSW 7 99767596 missense probably benign 0.37
R4709:Olfr521 UTSW 7 99767782 missense probably damaging 1.00
R5215:Olfr521 UTSW 7 99767510 missense probably damaging 1.00
R5934:Olfr521 UTSW 7 99767389 missense probably damaging 1.00
R6913:Olfr521 UTSW 7 99767717 missense probably damaging 1.00
R7394:Olfr521 UTSW 7 99767346 missense probably damaging 1.00
R7554:Olfr521 UTSW 7 99768003 missense possibly damaging 0.62
R7930:Olfr521 UTSW 7 99767596 missense probably benign 0.37
Z1177:Olfr521 UTSW 7 99767914 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTCATGGGCTTCTGCATTGC -3'
(R):5'- ACGAGGGAAAGTTCAGTCTACAC -3'

Sequencing Primer
(F):5'- GCTTCTGCATTGCCATGG -3'
(R):5'- AGTTCAGTCTACACCATTATGGG -3'
Posted On2016-11-21