Incidental Mutation 'R5752:Ttc41'
ID 444855
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms BC030307, Gnn
MMRRC Submission 043357-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R5752 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 86541675-86612708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86594210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 881 (T881I)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: T881I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: T881I

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219070
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330017A19Rik C A 17: 47,200,966 (GRCm39) probably benign Het
Aldh1l2 C A 10: 83,356,244 (GRCm39) G49C probably damaging Het
Arhgap26 G A 18: 39,419,725 (GRCm39) E11K probably damaging Het
Asns C T 6: 7,689,365 (GRCm39) G46S probably damaging Het
Atrn G T 2: 130,748,464 (GRCm39) probably benign Het
Cep126 A C 9: 8,120,746 (GRCm39) Y92* probably null Het
Cfap69 T C 5: 5,639,204 (GRCm39) T567A probably damaging Het
Clgn T A 8: 84,123,670 (GRCm39) Y61N probably damaging Het
Col28a1 T G 6: 8,015,025 (GRCm39) K793N possibly damaging Het
Cxcl9 C A 5: 92,471,715 (GRCm39) M108I probably benign Het
Cyp4f37 A T 17: 32,850,306 (GRCm39) I318F probably damaging Het
Daam1 T C 12: 71,993,320 (GRCm39) M363T unknown Het
Dnajc13 A C 9: 104,069,973 (GRCm39) probably null Het
Entpd2 G A 2: 25,289,781 (GRCm39) probably benign Het
F3 T A 3: 121,526,053 (GRCm39) N205K probably damaging Het
Fat2 A T 11: 55,180,063 (GRCm39) F1426Y possibly damaging Het
Galnt6 A T 15: 100,602,007 (GRCm39) F267I probably damaging Het
Gm1322 G A 2: 67,014,979 (GRCm39) noncoding transcript Het
Hdgfl3 A C 7: 81,549,451 (GRCm39) S143A possibly damaging Het
Ints7 T A 1: 191,308,005 (GRCm39) D12E probably benign Het
Kank3 A G 17: 34,037,037 (GRCm39) T114A probably benign Het
Lrp1b A G 2: 41,185,624 (GRCm39) Y1364H probably damaging Het
Mef2b A G 8: 70,618,267 (GRCm39) T116A possibly damaging Het
Megf8 C T 7: 25,054,539 (GRCm39) T1885I probably damaging Het
Mrps11 A G 7: 78,433,343 (GRCm39) K30E probably benign Het
Naca T A 10: 127,877,797 (GRCm39) probably benign Het
Ncoa4-ps A G 12: 119,226,349 (GRCm39) noncoding transcript Het
Nhsl3 GGTG GGTGTG 4: 129,117,773 (GRCm39) probably null Het
Or2at1 T C 7: 99,417,155 (GRCm39) I262T probably benign Het
Paip2b C T 6: 83,808,252 (GRCm39) probably null Het
Plcb2 G T 2: 118,541,532 (GRCm39) probably benign Het
Plcd4 A G 1: 74,587,131 (GRCm39) probably null Het
Pnpla8 A G 12: 44,329,670 (GRCm39) N74S probably benign Het
Pot1b A T 17: 55,994,834 (GRCm39) I276N probably damaging Het
Qprt C T 7: 126,708,416 (GRCm39) G5D probably benign Het
Rab11fip1 T C 8: 27,646,614 (GRCm39) N154S probably damaging Het
Rin3 G A 12: 102,279,378 (GRCm39) probably benign Het
Sdf4 C T 4: 156,080,761 (GRCm39) P37S probably damaging Het
Selp A T 1: 163,964,811 (GRCm39) D491V probably damaging Het
Sh3gl3 A G 7: 81,824,696 (GRCm39) probably benign Het
Sp110 G C 1: 85,504,923 (GRCm39) probably benign Het
Spata31d1e T C 13: 59,891,016 (GRCm39) Y268C probably damaging Het
Tas2r134 A G 2: 51,517,880 (GRCm39) R120G probably damaging Het
Tgfbr3 T C 5: 107,287,673 (GRCm39) R509G probably benign Het
Tle3 T A 9: 61,314,753 (GRCm39) Y231N probably damaging Het
Top6bl C A 19: 4,676,048 (GRCm39) A695S probably benign Het
Ttll8 T C 15: 88,816,931 (GRCm39) Y271C probably benign Het
Ttn A T 2: 76,778,328 (GRCm39) I1307K possibly damaging Het
Ube2k A G 5: 65,723,411 (GRCm39) D48G probably damaging Het
Vcan T C 13: 89,828,069 (GRCm39) T3126A probably damaging Het
Vps13d T C 4: 144,875,540 (GRCm39) T1656A probably benign Het
Zzz3 C A 3: 152,157,759 (GRCm39) S777R possibly damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86,572,797 (GRCm39) missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86,611,821 (GRCm39) missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86,612,542 (GRCm39) missense probably benign
IGL01707:Ttc41 APN 10 86,612,631 (GRCm39) missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86,566,890 (GRCm39) missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86,612,488 (GRCm39) missense probably benign 0.03
IGL01918:Ttc41 APN 10 86,549,054 (GRCm39) missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86,611,815 (GRCm39) missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86,596,778 (GRCm39) nonsense probably null
IGL02887:Ttc41 APN 10 86,569,518 (GRCm39) missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86,572,721 (GRCm39) missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86,594,212 (GRCm39) missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86,560,278 (GRCm39) critical splice donor site probably null
IGL03242:Ttc41 APN 10 86,612,683 (GRCm39) makesense probably null
IGL03307:Ttc41 APN 10 86,580,304 (GRCm39) missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
BB013:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0379:Ttc41 UTSW 10 86,548,841 (GRCm39) missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86,599,811 (GRCm39) missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86,594,961 (GRCm39) missense probably benign 0.00
R1589:Ttc41 UTSW 10 86,612,254 (GRCm39) missense probably benign 0.01
R1599:Ttc41 UTSW 10 86,612,437 (GRCm39) missense probably benign 0.04
R1608:Ttc41 UTSW 10 86,611,857 (GRCm39) missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86,612,116 (GRCm39) missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86,612,078 (GRCm39) missense probably benign
R2398:Ttc41 UTSW 10 86,549,250 (GRCm39) missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86,560,238 (GRCm39) missense probably benign 0.42
R3117:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86,565,662 (GRCm39) missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4841:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4842:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4884:Ttc41 UTSW 10 86,566,882 (GRCm39) missense probably benign 0.00
R4885:Ttc41 UTSW 10 86,594,966 (GRCm39) missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86,612,056 (GRCm39) missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86,580,408 (GRCm39) missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86,566,806 (GRCm39) missense probably benign 0.13
R5268:Ttc41 UTSW 10 86,580,342 (GRCm39) missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86,612,443 (GRCm39) missense probably benign 0.04
R5301:Ttc41 UTSW 10 86,555,384 (GRCm39) missense probably benign 0.00
R5425:Ttc41 UTSW 10 86,612,494 (GRCm39) missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86,596,784 (GRCm39) critical splice donor site probably null
R5635:Ttc41 UTSW 10 86,572,841 (GRCm39) missense probably benign 0.09
R5868:Ttc41 UTSW 10 86,586,128 (GRCm39) missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86,549,088 (GRCm39) missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86,594,952 (GRCm39) critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86,612,527 (GRCm39) missense probably benign 0.00
R6260:Ttc41 UTSW 10 86,569,571 (GRCm39) missense probably benign 0.32
R6260:Ttc41 UTSW 10 86,567,023 (GRCm39) missense probably benign 0.20
R6276:Ttc41 UTSW 10 86,580,313 (GRCm39) missense probably benign 0.01
R6458:Ttc41 UTSW 10 86,594,134 (GRCm39) missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86,549,367 (GRCm39) missense probably benign 0.17
R7348:Ttc41 UTSW 10 86,586,212 (GRCm39) nonsense probably null
R7382:Ttc41 UTSW 10 86,612,374 (GRCm39) missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86,549,296 (GRCm39) missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86,595,088 (GRCm39) missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86,612,495 (GRCm39) missense probably benign 0.02
R7926:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R7998:Ttc41 UTSW 10 86,572,711 (GRCm39) missense probably benign 0.01
R8021:Ttc41 UTSW 10 86,569,578 (GRCm39) missense probably benign
R8059:Ttc41 UTSW 10 86,548,842 (GRCm39) missense probably benign 0.01
R8170:Ttc41 UTSW 10 86,612,030 (GRCm39) missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86,555,494 (GRCm39) missense probably benign 0.06
R8375:Ttc41 UTSW 10 86,599,844 (GRCm39) missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86,555,390 (GRCm39) missense probably benign 0.00
R8698:Ttc41 UTSW 10 86,548,841 (GRCm39) missense probably benign 0.00
R8773:Ttc41 UTSW 10 86,565,679 (GRCm39) missense probably benign 0.35
R8902:Ttc41 UTSW 10 86,548,865 (GRCm39) missense probably benign 0.06
R8985:Ttc41 UTSW 10 86,566,956 (GRCm39) missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86,549,599 (GRCm39) missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86,569,625 (GRCm39) missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86,612,486 (GRCm39) missense probably benign 0.22
R9236:Ttc41 UTSW 10 86,612,594 (GRCm39) missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86,567,113 (GRCm39) missense probably benign 0.00
R9287:Ttc41 UTSW 10 86,599,830 (GRCm39) missense probably benign 0.43
R9345:Ttc41 UTSW 10 86,595,089 (GRCm39) missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86,548,890 (GRCm39) missense probably damaging 0.99
R9500:Ttc41 UTSW 10 86,565,726 (GRCm39) missense probably benign 0.03
R9570:Ttc41 UTSW 10 86,549,598 (GRCm39) missense possibly damaging 0.88
R9593:Ttc41 UTSW 10 86,549,049 (GRCm39) missense probably benign 0.24
X0024:Ttc41 UTSW 10 86,560,114 (GRCm39) missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86,565,661 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGATCTCATCATAGCCACTTATC -3'
(R):5'- AAAATTACCTAGCCAGTCCCTTTCC -3'

Sequencing Primer
(F):5'- AAATTTCTCTGAGAAGTGATGTTCTG -3'
(R):5'- AGTCCCTTTCCCTGAGAGAGAAG -3'
Posted On 2016-11-21