Incidental Mutation 'R5752:Ttc41'
ID444855
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Nametetratricopeptide repeat domain 41
SynonymsGnn, BC030307
MMRRC Submission 043357-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R5752 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86705811-86776844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86758346 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 881 (T881I)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632]
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: T881I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: T881I

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219070
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,202 Y268C probably damaging Het
A330017A19Rik C A 17: 46,890,040 probably benign Het
Aldh1l2 C A 10: 83,520,380 G49C probably damaging Het
Arhgap26 G A 18: 39,286,672 E11K probably damaging Het
Asns C T 6: 7,689,365 G46S probably damaging Het
Atrn G T 2: 130,906,544 probably benign Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cep126 A C 9: 8,120,745 Y92* probably null Het
Cfap69 T C 5: 5,589,204 T567A probably damaging Het
Clgn T A 8: 83,397,041 Y61N probably damaging Het
Col28a1 T G 6: 8,015,025 K793N possibly damaging Het
Cxcl9 C A 5: 92,323,856 M108I probably benign Het
Cyp4f37 A T 17: 32,631,332 I318F probably damaging Het
Daam1 T C 12: 71,946,546 M363T unknown Het
Dnajc13 A C 9: 104,192,774 probably null Het
Entpd2 G A 2: 25,399,769 probably benign Het
F3 T A 3: 121,732,404 N205K probably damaging Het
Fat2 A T 11: 55,289,237 F1426Y possibly damaging Het
Galnt6 A T 15: 100,704,126 F267I probably damaging Het
Gm1322 G A 2: 67,184,635 noncoding transcript Het
Gm6768 A G 12: 119,262,614 noncoding transcript Het
Gm960 C A 19: 4,626,020 A695S probably benign Het
Hdgfl3 A C 7: 81,899,703 S143A possibly damaging Het
Ints7 T A 1: 191,575,893 D12E probably benign Het
Kank3 A G 17: 33,818,063 T114A probably benign Het
Lrp1b A G 2: 41,295,612 Y1364H probably damaging Het
Mef2b A G 8: 70,165,617 T116A possibly damaging Het
Megf8 C T 7: 25,355,114 T1885I probably damaging Het
Mrps11 A G 7: 78,783,595 K30E probably benign Het
Naca T A 10: 128,041,928 probably benign Het
Olfr521 T C 7: 99,767,948 I262T probably benign Het
Paip2b C T 6: 83,831,270 probably null Het
Plcb2 G T 2: 118,711,051 probably benign Het
Plcd4 A G 1: 74,547,972 probably null Het
Pnpla8 A G 12: 44,282,887 N74S probably benign Het
Pot1b A T 17: 55,687,834 I276N probably damaging Het
Qprt C T 7: 127,109,244 G5D probably benign Het
Rab11fip1 T C 8: 27,156,586 N154S probably damaging Het
Rin3 G A 12: 102,313,119 probably benign Het
Sdf4 C T 4: 155,996,304 P37S probably damaging Het
Selp A T 1: 164,137,242 D491V probably damaging Het
Sh3gl3 A G 7: 82,174,948 probably benign Het
Sp110 G C 1: 85,577,202 probably benign Het
Tas2r134 A G 2: 51,627,868 R120G probably damaging Het
Tgfbr3 T C 5: 107,139,807 R509G probably benign Het
Tle3 T A 9: 61,407,471 Y231N probably damaging Het
Ttll8 T C 15: 88,932,728 Y271C probably benign Het
Ttn A T 2: 76,947,984 I1307K possibly damaging Het
Ube2k A G 5: 65,566,068 D48G probably damaging Het
Vcan T C 13: 89,679,950 T3126A probably damaging Het
Vps13d T C 4: 145,148,970 T1656A probably benign Het
Zzz3 C A 3: 152,452,122 S777R possibly damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACGATCTCATCATAGCCACTTATC -3'
(R):5'- AAAATTACCTAGCCAGTCCCTTTCC -3'

Sequencing Primer
(F):5'- AAATTTCTCTGAGAAGTGATGTTCTG -3'
(R):5'- AGTCCCTTTCCCTGAGAGAGAAG -3'
Posted On2016-11-21