Incidental Mutation 'H8786:Rela'
Institutional Source Beutler Lab
Gene Symbol Rela
Ensembl Gene ENSMUSG00000024927
Gene Namev-rel reticuloendotheliosis viral oncogene homolog A (avian)
Synonymsp65, p65 NF kappaB
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosomal Location5637483-5648130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5647018 bp
Amino Acid Change Serine to Threonine at position 418 (S418T)
Ref Sequence ENSEMBL: ENSMUSP00000025867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025867] [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000164304] [ENSMUST00000169854]
X-ray crystal structure of the IkBb/NF-kB p65 homodimer complex [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to an IFNb-kB [X-RAY DIFFRACTION]
Crystal structure of a NF-kB heterodimer bound to the Ig/HIV-kB siti [X-RAY DIFFRACTION]
The kB DNA sequence from the HLV-LTR functions as an allosteric regulator of HIV transcription [X-RAY DIFFRACTION]
NF-kappaB p65 subunit dimerization domain homodimer [X-RAY DIFFRACTION]
NF-kappaB p65 subunit dimerization domain homodimer N202R mutation [X-RAY DIFFRACTION]
>> 4 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000025867
AA Change: S418T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025867
Gene: ENSMUSG00000024927
AA Change: S418T

Pfam:RHD_DNA_bind 21 186 3.6e-72 PFAM
IPT 193 289 2.81e-22 SMART
low complexity region 377 389 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
PDB:2LWW|B 425 490 1e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000071857
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917

low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080824
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917

low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164304
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917

low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169854
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917

low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal due to hepatic apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Rela
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01905:Rela APN 19 5645564 missense probably benign 0.00
IGL02060:Rela APN 19 5638600 missense probably damaging 1.00
IGL02550:Rela APN 19 5641506 missense possibly damaging 0.58
IGL03130:Rela APN 19 5639881 missense probably damaging 1.00
R1597:Rela UTSW 19 5645331 missense probably damaging 0.99
R4455:Rela UTSW 19 5647262 missense probably damaging 1.00
R5322:Rela UTSW 19 5645380 missense possibly damaging 0.48
R5994:Rela UTSW 19 5647064 missense possibly damaging 0.59
R6006:Rela UTSW 19 5639939 missense probably damaging 1.00
R6301:Rela UTSW 19 5645410 splice site probably null
R6318:Rela UTSW 19 5646964 missense probably benign 0.01
R6556:Rela UTSW 19 5647338 missense probably damaging 1.00
R6646:Rela UTSW 19 5647104 missense probably damaging 0.98
R7697:Rela UTSW 19 5641602 missense probably damaging 1.00
Z1176:Rela UTSW 19 5641649 missense probably benign 0.04
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- atggtcccttcctcagccat -3'
Posted On2013-06-11