Incidental Mutation 'R5752:Gm6768'
ID444861
Institutional Source Beutler Lab
Gene Symbol Gm6768
Ensembl Gene ENSMUSG00000021908
Gene Namepredicted gene 6768
Synonyms
MMRRC Submission 043357-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R5752 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location119260934-119264272 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 119262614 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000022467
SMART Domains Protein: ENSMUSP00000136708
Gene: ENSMUSG00000021908

DomainStartEndE-ValueType
Pfam:ARA70 33 169 2.4e-28 PFAM
Pfam:ARA70 199 334 4.7e-51 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,743,202 Y268C probably damaging Het
A330017A19Rik C A 17: 46,890,040 probably benign Het
Aldh1l2 C A 10: 83,520,380 G49C probably damaging Het
Arhgap26 G A 18: 39,286,672 E11K probably damaging Het
Asns C T 6: 7,689,365 G46S probably damaging Het
Atrn G T 2: 130,906,544 probably benign Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cep126 A C 9: 8,120,745 Y92* probably null Het
Cfap69 T C 5: 5,589,204 T567A probably damaging Het
Clgn T A 8: 83,397,041 Y61N probably damaging Het
Col28a1 T G 6: 8,015,025 K793N possibly damaging Het
Cxcl9 C A 5: 92,323,856 M108I probably benign Het
Cyp4f37 A T 17: 32,631,332 I318F probably damaging Het
Daam1 T C 12: 71,946,546 M363T unknown Het
Dnajc13 A C 9: 104,192,774 probably null Het
Entpd2 G A 2: 25,399,769 probably benign Het
F3 T A 3: 121,732,404 N205K probably damaging Het
Fat2 A T 11: 55,289,237 F1426Y possibly damaging Het
Galnt6 A T 15: 100,704,126 F267I probably damaging Het
Gm1322 G A 2: 67,184,635 noncoding transcript Het
Gm960 C A 19: 4,626,020 A695S probably benign Het
Hdgfl3 A C 7: 81,899,703 S143A possibly damaging Het
Ints7 T A 1: 191,575,893 D12E probably benign Het
Kank3 A G 17: 33,818,063 T114A probably benign Het
Lrp1b A G 2: 41,295,612 Y1364H probably damaging Het
Mef2b A G 8: 70,165,617 T116A possibly damaging Het
Megf8 C T 7: 25,355,114 T1885I probably damaging Het
Mrps11 A G 7: 78,783,595 K30E probably benign Het
Naca T A 10: 128,041,928 probably benign Het
Olfr521 T C 7: 99,767,948 I262T probably benign Het
Paip2b C T 6: 83,831,270 probably null Het
Plcb2 G T 2: 118,711,051 probably benign Het
Plcd4 A G 1: 74,547,972 probably null Het
Pnpla8 A G 12: 44,282,887 N74S probably benign Het
Pot1b A T 17: 55,687,834 I276N probably damaging Het
Qprt C T 7: 127,109,244 G5D probably benign Het
Rab11fip1 T C 8: 27,156,586 N154S probably damaging Het
Rin3 G A 12: 102,313,119 probably benign Het
Sdf4 C T 4: 155,996,304 P37S probably damaging Het
Selp A T 1: 164,137,242 D491V probably damaging Het
Sh3gl3 A G 7: 82,174,948 probably benign Het
Sp110 G C 1: 85,577,202 probably benign Het
Tas2r134 A G 2: 51,627,868 R120G probably damaging Het
Tgfbr3 T C 5: 107,139,807 R509G probably benign Het
Tle3 T A 9: 61,407,471 Y231N probably damaging Het
Ttc41 C T 10: 86,758,346 T881I probably benign Het
Ttll8 T C 15: 88,932,728 Y271C probably benign Het
Ttn A T 2: 76,947,984 I1307K possibly damaging Het
Ube2k A G 5: 65,566,068 D48G probably damaging Het
Vcan T C 13: 89,679,950 T3126A probably damaging Het
Vps13d T C 4: 145,148,970 T1656A probably benign Het
Zzz3 C A 3: 152,452,122 S777R possibly damaging Het
Other mutations in Gm6768
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Gm6768 APN 12 119262496 exon noncoding transcript
R0683:Gm6768 UTSW 12 119261078 exon noncoding transcript
R1186:Gm6768 UTSW 12 119261471 exon noncoding transcript
R1485:Gm6768 UTSW 12 119261050 exon noncoding transcript
R1708:Gm6768 UTSW 12 119262233 exon noncoding transcript
R1800:Gm6768 UTSW 12 119261771 exon noncoding transcript
R2280:Gm6768 UTSW 12 119262838 exon noncoding transcript
R4827:Gm6768 UTSW 12 119261794 exon noncoding transcript
R4922:Gm6768 UTSW 12 119262517 exon noncoding transcript
R5183:Gm6768 UTSW 12 119261288 exon noncoding transcript
R5562:Gm6768 UTSW 12 119262222 exon noncoding transcript
R6033:Gm6768 UTSW 12 119261740 exon noncoding transcript
R6033:Gm6768 UTSW 12 119261740 exon noncoding transcript
R6084:Gm6768 UTSW 12 119261651 exon noncoding transcript
R6151:Gm6768 UTSW 12 119261106 exon noncoding transcript
X0024:Gm6768 UTSW 12 119261684 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CTCTGCCCTTCCAGAAATGAGC -3'
(R):5'- AGAGATCACAAACTGCTGGG -3'

Sequencing Primer
(F):5'- CTAAGGCACCCAAGGCTATGG -3'
(R):5'- ATCACAAACTGCTGGGAGGCC -3'
Posted On2016-11-21