Incidental Mutation 'H8786:Vwa2'
ID44488
Institutional Source Beutler Lab
Gene Symbol Vwa2
Ensembl Gene ENSMUSG00000025082
Gene Namevon Willebrand factor A domain containing 2
SynonymsAmaco
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location56874249-56912078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56909732 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 721 (M721K)
Ref Sequence ENSEMBL: ENSMUSP00000026068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068] [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026068
AA Change: M721K

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082
AA Change: M721K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111584
SMART Domains Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083

DomainStartEndE-ValueType
Blast:PH 30 153 3e-60 BLAST
low complexity region 160 170 N/A INTRINSIC
PH 194 291 9.27e-9 SMART
PH 372 467 3.11e-10 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
coiled coil region 675 772 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118800
SMART Domains Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083

DomainStartEndE-ValueType
Blast:PH 12 135 3e-60 BLAST
low complexity region 142 152 N/A INTRINSIC
PH 176 273 9.27e-9 SMART
PH 354 449 3.11e-10 SMART
low complexity region 513 525 N/A INTRINSIC
low complexity region 593 608 N/A INTRINSIC
coiled coil region 657 754 N/A INTRINSIC
low complexity region 773 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122359
SMART Domains Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083

DomainStartEndE-ValueType
Blast:PH 1 79 3e-32 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
PH 298 393 3.11e-10 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 537 552 N/A INTRINSIC
coiled coil region 601 698 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A-like domain protein superfamily. The encoded protein is localized to the extracellular matrix and may serve as a structural component in basement membranes or in anchoring structures on scaffolds of collagen VII or fibrillin. This gene has been linked to type 1A diabetes and is a candidate serological marker for colon cancer. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Atp13a3 A T 16: 30,359,725 C164* probably null Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Vwa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vwa2 APN 19 56901634 missense probably damaging 0.98
IGL02081:Vwa2 APN 19 56902236 missense probably benign 0.00
IGL02738:Vwa2 APN 19 56897929 missense possibly damaging 0.62
R0510:Vwa2 UTSW 19 56898068 splice site probably benign
R1061:Vwa2 UTSW 19 56908994 missense probably benign 0.35
R1350:Vwa2 UTSW 19 56909126 missense probably damaging 1.00
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1918:Vwa2 UTSW 19 56908934 missense probably benign 0.07
R2046:Vwa2 UTSW 19 56905578 missense probably benign 0.08
R3943:Vwa2 UTSW 19 56909315 missense probably damaging 1.00
R4278:Vwa2 UTSW 19 56903483 missense probably benign 0.00
R4745:Vwa2 UTSW 19 56906886 missense probably benign
R5081:Vwa2 UTSW 19 56909320 missense probably damaging 1.00
R5750:Vwa2 UTSW 19 56909231 missense probably benign 0.00
R5959:Vwa2 UTSW 19 56881172 missense possibly damaging 0.96
R6151:Vwa2 UTSW 19 56903465 critical splice acceptor site probably null
R6361:Vwa2 UTSW 19 56901526 critical splice acceptor site probably null
R6861:Vwa2 UTSW 19 56901593 missense probably benign 0.03
R7286:Vwa2 UTSW 19 56909359 missense probably benign
R7653:Vwa2 UTSW 19 56909335 missense probably benign 0.00
R7752:Vwa2 UTSW 19 56909240 missense probably damaging 1.00
R8038:Vwa2 UTSW 19 56897888 missense not run
X0020:Vwa2 UTSW 19 56909201 missense probably damaging 1.00
X0066:Vwa2 UTSW 19 56886985 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTTACCGACCATGTGCTAAGCTG -3'
(R):5'- GCAATGCACGGAACTCCCAATG -3'

Sequencing Primer
(F):5'- CCATGTGCTAAGCTGTTGCTG -3'
(R):5'- cactgctcactctgtctcc -3'
Posted On2013-06-11