Incidental Mutation 'R5753:Olfr1301'
ID444880
Institutional Source Beutler Lab
Gene Symbol Olfr1301
Ensembl Gene ENSMUSG00000057149
Gene Nameolfactory receptor 1301
SynonymsGA_x6K02T2Q125-72805651-72806589, MOR248-5
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111751006-111758852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111754801 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 184 (I184K)
Ref Sequence ENSEMBL: ENSMUSP00000146530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080094] [ENSMUST00000207590]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080094
AA Change: I184K

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078993
Gene: ENSMUSG00000057149
AA Change: I184K

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.1e-53 PFAM
Pfam:7tm_1 41 287 2.2e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207590
AA Change: I184K

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Olfr1301
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Olfr1301 APN 2 111754426 missense probably damaging 1.00
IGL01396:Olfr1301 APN 2 111754603 missense probably damaging 1.00
IGL01396:Olfr1301 APN 2 111754503 missense probably benign 0.01
IGL01538:Olfr1301 APN 2 111755005 missense probably damaging 0.98
IGL01795:Olfr1301 APN 2 111754386 missense probably benign 0.00
IGL02007:Olfr1301 APN 2 111754479 missense probably damaging 0.99
IGL02738:Olfr1301 APN 2 111754354 missense probably damaging 1.00
IGL03365:Olfr1301 APN 2 111754427 missense possibly damaging 0.95
R0014:Olfr1301 UTSW 2 111754774 missense probably damaging 1.00
R0115:Olfr1301 UTSW 2 111754585 missense probably damaging 1.00
R0481:Olfr1301 UTSW 2 111754585 missense probably damaging 1.00
R1441:Olfr1301 UTSW 2 111755002 missense probably damaging 1.00
R1583:Olfr1301 UTSW 2 111754425 missense probably damaging 0.98
R2091:Olfr1301 UTSW 2 111754386 missense probably benign 0.00
R2301:Olfr1301 UTSW 2 111754276 missense probably benign 0.01
R2363:Olfr1301 UTSW 2 111754794 missense probably damaging 0.97
R2511:Olfr1301 UTSW 2 111754316 missense probably benign 0.00
R3686:Olfr1301 UTSW 2 111754569 missense probably benign 0.00
R4841:Olfr1301 UTSW 2 111754334 missense probably benign 0.00
R4915:Olfr1301 UTSW 2 111754380 missense probably benign 0.00
R4961:Olfr1301 UTSW 2 111754405 missense probably damaging 1.00
R5123:Olfr1301 UTSW 2 111754552 missense probably damaging 1.00
R5417:Olfr1301 UTSW 2 111754920 missense possibly damaging 0.50
R5654:Olfr1301 UTSW 2 111754981 missense probably damaging 1.00
R6361:Olfr1301 UTSW 2 111754595 missense probably damaging 1.00
R6525:Olfr1301 UTSW 2 111754984 missense probably benign 0.09
R6682:Olfr1301 UTSW 2 111754635 missense probably damaging 1.00
R7099:Olfr1301 UTSW 2 111755076 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGTGGCCATCTGCAAACC -3'
(R):5'- GGCCACACATAGATGAAGATGC -3'

Sequencing Primer
(F):5'- GTGGCCATCTGCAAACCACTTC -3'
(R):5'- CACTACTGTGATGTGAGCAGTGC -3'
Posted On2016-11-21