Mutagenetix > Incidental Mutation

Incidental Mutation 'R5753:Vmn2r12'

444886

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r12

Ensembl Gene

ENSMUSG00000090688

Gene Name

vomeronasal 2, receptor 12

Synonyms

Gm6769

MMRRC Submission

043358-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R5753 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109085849-109097864 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 109091804 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 298 (W298R)

Ref Sequence

ENSEMBL: ENSMUSP00000093612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095922]

AlphaFold

L7N217

Predicted Effect

probably damaging
Transcript: ENSMUST00000095922
AA Change: W298R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: W298R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	76	466	8.8e-30	PFAM
Pfam:NCD3G	505	559	1.7e-18	PFAM
Pfam:7tm_3	591	827	3.9e-54	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

97% (58/60)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	C	T	5: 87,972,515	T377I	probably damaging	Het
Abcb1a	A	G	5: 8,723,160	D796G	probably damaging	Het
Actn3	T	C	19: 4,864,567		probably null	Het
Ada	A	T	2: 163,735,398	S57T	probably benign	Het
Adamts6	A	G	13: 104,347,350	Y359C	probably damaging	Het
Adcy1	A	T	11: 7,130,300	I348F	probably damaging	Het
Ankrd11	T	C	8: 122,895,304	E603G	possibly damaging	Het
Bcas3	A	G	11: 85,822,084		probably benign	Het
Cldn1	C	A	16: 26,363,121	V113L	probably benign	Het
Dock9	T	C	14: 121,634,625	T540A	probably benign	Het
Erp27	A	G	6: 136,919,877	F109S	probably damaging	Het
F13a1	G	A	13: 36,898,108	Q541*	probably null	Het
Fam124a	T	C	14: 62,606,539	S499P	probably benign	Het
Fgd3	T	A	13: 49,274,940	E486V	possibly damaging	Het
Flnc	T	C	6: 29,433,489	S11P	probably benign	Het
Gm12508	C	A	4: 55,254,787		noncoding transcript	Het
Grk2	C	T	19: 4,290,468	R295H	probably damaging	Het
Gtf2ird1	A	G	5: 134,410,983	M131T	probably damaging	Het
Hist1h4d	G	A	13: 23,581,604	M1I	probably null	Het
Itpripl2	A	G	7: 118,491,009	V109A	probably damaging	Het
Jakmip2	T	C	18: 43,559,116	E585G	probably damaging	Het
Kbtbd3	A	T	9: 4,331,404	I593F	possibly damaging	Het
Lgr4	C	T	2: 110,002,512	Q316*	probably null	Het
Mcf2l	T	C	8: 12,999,993	F305S	probably damaging	Het
Nos1ap	T	A	1: 170,349,399	K145M	probably damaging	Het
Olfr1143	A	T	2: 87,803,252	M288L	probably benign	Het
Olfr1264	T	C	2: 90,021,503	T188A	possibly damaging	Het
Olfr1301	T	A	2: 111,754,801	I184K	possibly damaging	Het
Olfr19	A	T	16: 16,673,620	Y120*	probably null	Het
Olfr64	A	G	7: 103,893,201	L178P	probably damaging	Het
Olfr73	G	A	2: 88,034,576	L188F	probably damaging	Het
Olfr735	T	A	14: 50,345,588	T285S	probably damaging	Het
Pcdh9	T	A	14: 93,888,161	D191V	probably damaging	Het
Pde4d	T	A	13: 109,772,722		probably benign	Het
Phkb	C	T	8: 85,878,230	A88V	probably damaging	Het
Plec	A	G	15: 76,173,420	S4128P	probably damaging	Het
Plekha5	A	T	6: 140,537,004		probably null	Het
Rgs13	A	C	1: 144,140,740	N88K	probably benign	Het
Rho	T	A	6: 115,935,487	I104N	probably damaging	Het
Rnps1	T	C	17: 24,418,164		probably benign	Het
Slc10a7	G	T	8: 78,525,299		probably null	Het
Slc39a7	C	T	17: 34,030,176	R246K	probably damaging	Het
Sort1	G	C	3: 108,345,774	G510A	probably damaging	Het
Spag6l	A	G	16: 16,766,967		probably null	Het
Sync	T	A	4: 129,293,386	Y70*	probably null	Het
Tex45	A	T	8: 3,484,112	I350L	probably benign	Het
Timm8a2	T	C	14: 122,034,877	V64A	probably benign	Het
Tnfrsf11b	C	A	15: 54,254,059	V267L	possibly damaging	Het
Trim30b	A	G	7: 104,357,337	V104A	possibly damaging	Het
Tusc3	T	C	8: 39,096,946	S244P	probably damaging	Het
Usp16	T	A	16: 87,482,899	Y746N	probably damaging	Het
Vax1	G	T	19: 59,166,382	H274Q	probably benign	Het
Vmn2r108	A	G	17: 20,462,917	V675A	probably damaging	Het
Zfp948	A	G	17: 21,586,894	N116S	probably damaging	Het
Zkscan2	A	G	7: 123,480,700	V678A	probably benign	Het

Other mutations in Vmn2r12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00948:Vmn2r12	APN	5	109097675	missense	possibly damaging	0.47
IGL01096:Vmn2r12	APN	5	109086259	missense	probably damaging	1.00
IGL01538:Vmn2r12	APN	5	109091850	missense	probably damaging	1.00
IGL01548:Vmn2r12	APN	5	109093027	nonsense	probably null
IGL01762:Vmn2r12	APN	5	109086564	missense	probably damaging	0.99
IGL01860:Vmn2r12	APN	5	109092159	missense	probably benign	0.10
IGL02269:Vmn2r12	APN	5	109086477	missense	probably damaging	1.00
IGL02530:Vmn2r12	APN	5	109085992	missense	probably damaging	1.00
IGL02887:Vmn2r12	APN	5	109090485	missense	probably benign	0.03
IGL03265:Vmn2r12	APN	5	109092070	missense	probably benign	0.05
R0396:Vmn2r12	UTSW	5	109092899	missense	probably benign	0.00
R0497:Vmn2r12	UTSW	5	109091889	nonsense	probably null
R0529:Vmn2r12	UTSW	5	109092848	missense	probably benign
R0715:Vmn2r12	UTSW	5	109090507	missense	probably benign	0.10
R0742:Vmn2r12	UTSW	5	109086415	missense	possibly damaging	0.55
R0894:Vmn2r12	UTSW	5	109087850	critical splice donor site	probably null
R1173:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1174:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1259:Vmn2r12	UTSW	5	109091897	missense	probably damaging	0.97
R1349:Vmn2r12	UTSW	5	109086586	missense	probably benign	0.00
R1388:Vmn2r12	UTSW	5	109092974	missense	possibly damaging	0.56
R1549:Vmn2r12	UTSW	5	109092830	missense	probably benign	0.06
R1766:Vmn2r12	UTSW	5	109092044	missense	probably damaging	1.00
R1781:Vmn2r12	UTSW	5	109091728	missense	probably benign	0.00
R1885:Vmn2r12	UTSW	5	109092076	missense	probably damaging	1.00
R2159:Vmn2r12	UTSW	5	109091474	missense	probably benign	0.02
R2420:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2421:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2422:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2937:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R2938:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R3898:Vmn2r12	UTSW	5	109090504	missense	probably benign	0.02
R4061:Vmn2r12	UTSW	5	109092192	missense	possibly damaging	0.95
R4063:Vmn2r12	UTSW	5	109092192	missense	possibly damaging	0.95
R4090:Vmn2r12	UTSW	5	109091546	missense	probably benign	0.06
R4297:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4298:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4299:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4304:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4306:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4307:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4308:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4594:Vmn2r12	UTSW	5	109086435	missense	probably damaging	1.00
R4783:Vmn2r12	UTSW	5	109086513	missense	probably damaging	1.00
R4900:Vmn2r12	UTSW	5	109092986	missense	probably damaging	1.00
R4929:Vmn2r12	UTSW	5	109091678	missense	probably damaging	1.00
R4974:Vmn2r12	UTSW	5	109091506	missense	probably damaging	1.00
R5389:Vmn2r12	UTSW	5	109090395	missense	probably benign	0.00
R5431:Vmn2r12	UTSW	5	109091818	missense	probably damaging	0.99
R5527:Vmn2r12	UTSW	5	109086617	nonsense	probably null
R5639:Vmn2r12	UTSW	5	109092800	missense	probably benign	0.06
R5797:Vmn2r12	UTSW	5	109085870	nonsense	probably null
R6142:Vmn2r12	UTSW	5	109092897	missense	probably benign
R6162:Vmn2r12	UTSW	5	109086564	missense	probably damaging	0.99
R6176:Vmn2r12	UTSW	5	109086000	missense	probably benign	0.43
R6853:Vmn2r12	UTSW	5	109092905	missense	probably damaging	1.00
R7238:Vmn2r12	UTSW	5	109097789	missense	possibly damaging	0.81
R7341:Vmn2r12	UTSW	5	109086247	missense	possibly damaging	0.74
R7341:Vmn2r12	UTSW	5	109091945	missense	possibly damaging	0.95
R7383:Vmn2r12	UTSW	5	109092818	missense	probably benign	0.19
R7740:Vmn2r12	UTSW	5	109091749	missense	probably damaging	1.00
R7749:Vmn2r12	UTSW	5	109086054	missense	probably damaging	0.99
R7861:Vmn2r12	UTSW	5	109087963	missense	probably benign	0.00
R7908:Vmn2r12	UTSW	5	109086441	missense	probably damaging	1.00
R8128:Vmn2r12	UTSW	5	109091881	missense	possibly damaging	0.81
R8175:Vmn2r12	UTSW	5	109090483	missense	probably damaging	0.97
R8234:Vmn2r12	UTSW	5	109086208	missense	probably benign	0.01
R8771:Vmn2r12	UTSW	5	109092086	missense	possibly damaging	0.95
R8947:Vmn2r12	UTSW	5	109086656	missense	possibly damaging	0.64
R8991:Vmn2r12	UTSW	5	109086167	nonsense	probably null
R9116:Vmn2r12	UTSW	5	109086019	missense	probably damaging	1.00
R9122:Vmn2r12	UTSW	5	109093044	missense	probably benign	0.00
R9153:Vmn2r12	UTSW	5	109086337	missense	probably damaging	1.00
R9371:Vmn2r12	UTSW	5	109086586	missense	probably benign	0.00
R9375:Vmn2r12	UTSW	5	109086120	missense	probably damaging	1.00
R9524:Vmn2r12	UTSW	5	109091957	missense	probably damaging	1.00
R9587:Vmn2r12	UTSW	5	109091456	missense	probably damaging	0.99
Z1088:Vmn2r12	UTSW	5	109092780	missense	probably benign
Z1176:Vmn2r12	UTSW	5	109091437	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTGCTGTCCATTCCAATGTG -3'
(R):5'- TGATCCCAGAAGACATGCAG -3'

Sequencing Primer
(F):5'- CCATTCCAATGTGTTGTTGAATG -3'
(R):5'- CATGCAGTTATATATGACAAGGGCTG -3'

Posted On

2016-11-21