Incidental Mutation 'R5753:Olfr64'
ID444892
Institutional Source Beutler Lab
Gene Symbol Olfr64
Ensembl Gene ENSMUSG00000063615
Gene Nameolfactory receptor 64
SynonymsGA_x6K02T2PBJ9-6648196-6649143, 5'[b]2, MOR1-2
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103889485-103894485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103893201 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 178 (L178P)
Ref Sequence ENSEMBL: ENSMUSP00000080444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081748]
Predicted Effect probably damaging
Transcript: ENSMUST00000081748
AA Change: L178P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080444
Gene: ENSMUSG00000063615
AA Change: L178P

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.4e-113 PFAM
Pfam:7TM_GPCR_Srsx 33 295 4.2e-6 PFAM
Pfam:7tm_1 39 290 1.1e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Olfr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Olfr64 APN 7 103892864 nonsense probably null
IGL01597:Olfr64 APN 7 103893096 missense probably benign 0.01
IGL01868:Olfr64 APN 7 103893376 nonsense probably null
IGL02502:Olfr64 APN 7 103893489 missense probably damaging 0.99
R0294:Olfr64 UTSW 7 103892930 missense probably benign 0.09
R0534:Olfr64 UTSW 7 103893231 missense probably benign 0.00
R0838:Olfr64 UTSW 7 103893415 missense probably benign 0.00
R1350:Olfr64 UTSW 7 103893730 missense probably benign 0.01
R1733:Olfr64 UTSW 7 103892911 missense probably benign 0.40
R1768:Olfr64 UTSW 7 103893277 missense probably benign 0.28
R1780:Olfr64 UTSW 7 103893555 missense probably damaging 1.00
R1836:Olfr64 UTSW 7 103893385 missense probably damaging 0.98
R1956:Olfr64 UTSW 7 103893718 missense probably benign 0.01
R2075:Olfr64 UTSW 7 103892920 missense probably damaging 0.96
R4677:Olfr64 UTSW 7 103893408 missense probably damaging 1.00
R4884:Olfr64 UTSW 7 103893655 missense probably benign 0.04
R4899:Olfr64 UTSW 7 103893465 missense possibly damaging 0.54
R6351:Olfr64 UTSW 7 103893135 nonsense probably null
R6997:Olfr64 UTSW 7 103893031 missense probably benign 0.00
X0017:Olfr64 UTSW 7 103893151 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGCCAATCACAGTGATG -3'
(R):5'- GATTTGTCGCCATCTGCACAC -3'

Sequencing Primer
(F):5'- TCAGGCCAATCACAGTGATGTAAAAG -3'
(R):5'- TCTGCACACCTCTGCATTACAAC -3'
Posted On2016-11-21