Incidental Mutation 'R5753:Mcf2l'
ID444897
Institutional Source Beutler Lab
Gene Symbol Mcf2l
Ensembl Gene ENSMUSG00000031442
Gene Namemcf.2 transforming sequence-like
SynonymsC130040G20Rik, Dbs
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location12873806-13020905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12999993 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 305 (F305S)
Ref Sequence ENSEMBL: ENSMUSP00000133776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095456] [ENSMUST00000098927] [ENSMUST00000110866] [ENSMUST00000110867] [ENSMUST00000110871] [ENSMUST00000110873] [ENSMUST00000110876] [ENSMUST00000110879] [ENSMUST00000145067] [ENSMUST00000173006] [ENSMUST00000173099]
Predicted Effect probably damaging
Transcript: ENSMUST00000095456
AA Change: F339S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093108
Gene: ENSMUSG00000031442
AA Change: F339S

DomainStartEndE-ValueType
SEC14 75 221 1.77e-24 SMART
SPEC 354 455 4.41e-15 SMART
coiled coil region 507 529 N/A INTRINSIC
low complexity region 578 594 N/A INTRINSIC
RhoGEF 636 811 2.83e-63 SMART
PH 831 948 8.13e-14 SMART
low complexity region 966 978 N/A INTRINSIC
SH3 1058 1115 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098927
AA Change: F313S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096528
Gene: ENSMUSG00000031442
AA Change: F313S

DomainStartEndE-ValueType
SEC14 49 195 1.77e-24 SMART
SPEC 328 429 4.41e-15 SMART
coiled coil region 481 503 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
RhoGEF 610 785 2.83e-63 SMART
PH 805 922 8.13e-14 SMART
low complexity region 940 952 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110866
AA Change: F287S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106490
Gene: ENSMUSG00000031442
AA Change: F287S

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110867
AA Change: F287S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106491
Gene: ENSMUSG00000031442
AA Change: F287S

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110871
AA Change: F307S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106495
Gene: ENSMUSG00000031442
AA Change: F307S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SEC14 43 189 1.77e-24 SMART
SPEC 322 423 4.41e-15 SMART
coiled coil region 475 497 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
RhoGEF 604 779 2.83e-63 SMART
PH 799 916 8.13e-14 SMART
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110873
AA Change: F150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106497
Gene: ENSMUSG00000031442
AA Change: F150S

DomainStartEndE-ValueType
SPEC 165 266 4.41e-15 SMART
coiled coil region 318 340 N/A INTRINSIC
low complexity region 389 405 N/A INTRINSIC
RhoGEF 447 622 2.83e-63 SMART
PH 642 759 8.13e-14 SMART
low complexity region 777 789 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110876
AA Change: F309S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106500
Gene: ENSMUSG00000031442
AA Change: F309S

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1084 1141 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110879
AA Change: F309S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106503
Gene: ENSMUSG00000031442
AA Change: F309S

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1028 1085 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126905
SMART Domains Protein: ENSMUSP00000118540
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SPEC 5 88 8.25e-6 SMART
coiled coil region 139 161 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
RhoGEF 269 444 2.83e-63 SMART
PH 464 581 8.13e-14 SMART
low complexity region 599 611 N/A INTRINSIC
SH3 716 773 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145067
AA Change: F246S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133577
Gene: ENSMUSG00000031442
AA Change: F246S

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 16 132 2.4e-12 PFAM
SPEC 261 362 4.41e-15 SMART
coiled coil region 414 436 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
RhoGEF 543 718 2.83e-63 SMART
PH 738 855 8.13e-14 SMART
low complexity region 873 885 N/A INTRINSIC
SH3 1021 1078 3.33e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173006
AA Change: F218S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134147
Gene: ENSMUSG00000031442
AA Change: F218S

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 1 104 1.3e-12 PFAM
SPEC 233 334 4.41e-15 SMART
coiled coil region 386 408 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
RhoGEF 515 690 2.83e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173099
AA Change: F305S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133776
Gene: ENSMUSG00000031442
AA Change: F305S

DomainStartEndE-ValueType
SEC14 41 187 1.77e-24 SMART
SPEC 320 421 4.41e-15 SMART
coiled coil region 473 495 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
RhoGEF 602 777 2.83e-63 SMART
PH 797 914 8.13e-14 SMART
low complexity region 932 944 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.7368 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Mcf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Mcf2l APN 8 13000857 missense probably damaging 0.98
IGL00426:Mcf2l APN 8 12984910 missense probably damaging 1.00
IGL01391:Mcf2l APN 8 13014010 splice site probably null
IGL01795:Mcf2l APN 8 13000749 unclassified probably null
IGL02314:Mcf2l APN 8 13001851 missense probably damaging 0.99
IGL02716:Mcf2l APN 8 12997277 missense probably benign 0.19
IGL02985:Mcf2l APN 8 12963239 missense probably damaging 1.00
IGL03073:Mcf2l APN 8 13000004 missense probably damaging 1.00
IGL03308:Mcf2l APN 8 13009512 missense probably damaging 1.00
IGL03371:Mcf2l APN 8 13001298 missense probably damaging 1.00
P0022:Mcf2l UTSW 8 13018897 nonsense probably null
R0062:Mcf2l UTSW 8 13006766 unclassified probably benign
R0067:Mcf2l UTSW 8 13013060 missense probably benign 0.01
R0110:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0450:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0469:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0510:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0543:Mcf2l UTSW 8 12996728 critical splice donor site probably null
R0591:Mcf2l UTSW 8 13018751 missense probably benign 0.11
R0801:Mcf2l UTSW 8 13014020 intron probably benign
R0962:Mcf2l UTSW 8 13001964 missense probably benign 0.14
R1084:Mcf2l UTSW 8 13002645 missense possibly damaging 0.94
R1794:Mcf2l UTSW 8 12915982 missense probably benign 0.33
R2111:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R2112:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R3785:Mcf2l UTSW 8 12880099 missense probably damaging 0.97
R4777:Mcf2l UTSW 8 13018051 splice site probably null
R4858:Mcf2l UTSW 8 13013972 missense probably damaging 1.00
R4980:Mcf2l UTSW 8 12984883 missense probably damaging 1.00
R5021:Mcf2l UTSW 8 13011808 missense probably damaging 1.00
R5067:Mcf2l UTSW 8 12915959 intron probably benign
R5158:Mcf2l UTSW 8 13009715 missense probably damaging 1.00
R5439:Mcf2l UTSW 8 12926646 missense possibly damaging 0.85
R5569:Mcf2l UTSW 8 13005481 missense probably damaging 1.00
R5655:Mcf2l UTSW 8 13010444 missense probably damaging 0.98
R5668:Mcf2l UTSW 8 13013812 nonsense probably null
R5808:Mcf2l UTSW 8 12993937 start codon destroyed probably null 0.92
R5946:Mcf2l UTSW 8 13013922 missense probably damaging 1.00
R6168:Mcf2l UTSW 8 13001823 missense probably benign 0.05
R6174:Mcf2l UTSW 8 13013849 nonsense probably null
R6212:Mcf2l UTSW 8 13017431 missense probably damaging 1.00
R6270:Mcf2l UTSW 8 13018701 missense probably damaging 0.99
R6383:Mcf2l UTSW 8 12879912 start gained probably benign
R6850:Mcf2l UTSW 8 13009476 missense possibly damaging 0.82
R6908:Mcf2l UTSW 8 13018919 missense probably benign
R7101:Mcf2l UTSW 8 13013579 missense possibly damaging 0.80
R7163:Mcf2l UTSW 8 12915439 missense probably benign 0.00
R7203:Mcf2l UTSW 8 13010456 missense probably benign 0.09
R7414:Mcf2l UTSW 8 13019022 makesense probably null
R7553:Mcf2l UTSW 8 12997268 missense probably benign
R7556:Mcf2l UTSW 8 12973071 missense probably damaging 0.99
R7688:Mcf2l UTSW 8 12948130 missense possibly damaging 0.74
R7776:Mcf2l UTSW 8 12880127 missense probably benign
X0052:Mcf2l UTSW 8 13018713 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCTGAGAACTGTAGGAGTTGG -3'
(R):5'- GAAAGCCTTCTTCAGTTGCC -3'

Sequencing Primer
(F):5'- ACTGTAGGAGTTGGCACATG -3'
(R):5'- GTTGTGGTGACCCCCAATCATAAG -3'
Posted On2016-11-21