Incidental Mutation 'R5753:Phkb'
ID444900
Institutional Source Beutler Lab
Gene Symbol Phkb
Ensembl Gene ENSMUSG00000036879
Gene Namephosphorylase kinase beta
Synonyms
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85840959-86061376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85878230 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 88 (A88V)
Ref Sequence ENSEMBL: ENSMUSP00000125197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053771] [ENSMUST00000160611] [ENSMUST00000161850] [ENSMUST00000162464] [ENSMUST00000162981]
Predicted Effect probably damaging
Transcript: ENSMUST00000053771
AA Change: A88V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050788
Gene: ENSMUSG00000036879
AA Change: A88V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 870 1.5e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159882
Predicted Effect probably damaging
Transcript: ENSMUST00000160611
AA Change: A88V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125690
Gene: ENSMUSG00000036879
AA Change: A88V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 164 3.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161850
AA Change: A96V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124939
Gene: ENSMUSG00000036879
AA Change: A96V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 47 206 3.9e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162464
AA Change: A88V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125197
Gene: ENSMUSG00000036879
AA Change: A88V

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 163 7.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162981
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Phkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Phkb APN 8 85957587 missense probably benign 0.42
IGL01126:Phkb APN 8 85946101 missense probably benign 0.12
IGL01700:Phkb APN 8 86017465 missense probably benign 0.06
IGL01761:Phkb APN 8 86019064 missense probably benign 0.01
IGL02404:Phkb APN 8 85878115 missense possibly damaging 0.94
IGL02672:Phkb APN 8 85942358 missense probably benign
IGL02682:Phkb APN 8 85875646 makesense probably null
IGL02693:Phkb APN 8 85942234 missense probably damaging 1.00
IGL02798:Phkb APN 8 86043777 missense probably benign
IGL02888:Phkb APN 8 85935472 critical splice donor site probably null
IGL03106:Phkb APN 8 86018466 splice site probably benign
PIT4544001:Phkb UTSW 8 86011637 missense probably benign 0.42
R0088:Phkb UTSW 8 85942391 critical splice donor site probably null
R0107:Phkb UTSW 8 86016931 missense probably benign 0.01
R0504:Phkb UTSW 8 86056524 missense probably benign
R0569:Phkb UTSW 8 86017402 missense probably damaging 1.00
R0671:Phkb UTSW 8 85875693 missense probably damaging 0.97
R0894:Phkb UTSW 8 86017441 missense probably damaging 1.00
R1491:Phkb UTSW 8 85875657 missense possibly damaging 0.90
R1502:Phkb UTSW 8 86059339 missense possibly damaging 0.69
R1595:Phkb UTSW 8 86026553 splice site probably benign
R1686:Phkb UTSW 8 86021649 missense probably benign
R1913:Phkb UTSW 8 85901920 missense possibly damaging 0.95
R1919:Phkb UTSW 8 85922161 missense probably benign 0.17
R1968:Phkb UTSW 8 85970951 missense probably benign 0.07
R2008:Phkb UTSW 8 86056467 missense probably damaging 1.00
R2051:Phkb UTSW 8 86049821 critical splice donor site probably null
R2148:Phkb UTSW 8 86017486 missense probably damaging 0.96
R2305:Phkb UTSW 8 86043802 missense possibly damaging 0.80
R3801:Phkb UTSW 8 85922229 nonsense probably null
R3804:Phkb UTSW 8 85922229 nonsense probably null
R4159:Phkb UTSW 8 86021533 splice site probably null
R4624:Phkb UTSW 8 85848712 intron probably benign
R4833:Phkb UTSW 8 85901911 missense probably damaging 1.00
R5017:Phkb UTSW 8 86049809 missense probably benign
R5169:Phkb UTSW 8 85896491 missense probably benign 0.01
R5337:Phkb UTSW 8 85878245 missense probably damaging 1.00
R5391:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5395:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5480:Phkb UTSW 8 85922182 missense probably damaging 1.00
R5538:Phkb UTSW 8 85922127 missense possibly damaging 0.80
R5623:Phkb UTSW 8 85843048 unclassified probably benign
R5909:Phkb UTSW 8 86021447 critical splice donor site probably null
R5929:Phkb UTSW 8 85970914 missense probably benign 0.01
R6093:Phkb UTSW 8 85942329 missense probably damaging 1.00
R6320:Phkb UTSW 8 85875698 missense probably benign 0.00
R6324:Phkb UTSW 8 86018542 missense probably benign 0.00
R6626:Phkb UTSW 8 85922151 missense probably damaging 0.96
R6687:Phkb UTSW 8 86029546 missense probably damaging 1.00
R6848:Phkb UTSW 8 86029617 missense probably damaging 0.99
R7228:Phkb UTSW 8 85843007 unclassified probably benign
R7260:Phkb UTSW 8 85878130 missense probably benign 0.07
R7271:Phkb UTSW 8 86043789 missense probably damaging 1.00
X0021:Phkb UTSW 8 86029635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGCTAGAGTTACATGAAGC -3'
(R):5'- TTACCTGTTAGAAGTATCTCGAGAG -3'

Sequencing Primer
(F):5'- GCTAGAGTTACATGAAGCAGTTTAAC -3'
(R):5'- TCGAGAGAGAGAAAAAGGCCATTC -3'
Posted On2016-11-21