Incidental Mutation 'R5753:Fgd3'
ID444907
Institutional Source Beutler Lab
Gene Symbol Fgd3
Ensembl Gene ENSMUSG00000037946
Gene NameFYVE, RhoGEF and PH domain containing 3
SynonymsZFYVE5, 5830461L01Rik
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49261554-49320311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49274940 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 486 (E486V)
Ref Sequence ENSEMBL: ENSMUSP00000105714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048716] [ENSMUST00000110086] [ENSMUST00000110087]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048716
AA Change: E486V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048692
Gene: ENSMUSG00000037946
AA Change: E486V

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110086
AA Change: E486V

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105713
Gene: ENSMUSG00000037946
AA Change: E486V

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110087
AA Change: E486V

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105714
Gene: ENSMUSG00000037946
AA Change: E486V

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Spag6l A G 16: 16,766,967 probably null Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Fgd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fgd3 APN 13 49275643 splice site probably benign
IGL00816:Fgd3 APN 13 49264786 splice site probably benign
IGL01797:Fgd3 APN 13 49289589 missense probably damaging 1.00
IGL01993:Fgd3 APN 13 49280188 missense possibly damaging 0.62
IGL02134:Fgd3 APN 13 49296749 missense possibly damaging 0.84
IGL02327:Fgd3 APN 13 49285798 missense probably damaging 1.00
IGL02367:Fgd3 APN 13 49287326 missense probably damaging 1.00
IGL02532:Fgd3 APN 13 49285761 missense probably damaging 1.00
IGL02830:Fgd3 APN 13 49264631 splice site probably benign
IGL02888:Fgd3 APN 13 49281816 critical splice donor site probably null
IGL03209:Fgd3 APN 13 49285818 missense probably damaging 1.00
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0285:Fgd3 UTSW 13 49263948 missense possibly damaging 0.89
R0526:Fgd3 UTSW 13 49296524 missense probably benign 0.00
R0617:Fgd3 UTSW 13 49264697 missense possibly damaging 0.80
R0648:Fgd3 UTSW 13 49296573 missense probably benign 0.23
R1529:Fgd3 UTSW 13 49266694 missense probably benign 0.19
R1577:Fgd3 UTSW 13 49281937 missense probably damaging 0.99
R1913:Fgd3 UTSW 13 49263848 missense possibly damaging 0.89
R2002:Fgd3 UTSW 13 49296455 missense probably benign 0.05
R4342:Fgd3 UTSW 13 49273709 critical splice donor site probably null
R4606:Fgd3 UTSW 13 49296560 missense probably damaging 1.00
R4810:Fgd3 UTSW 13 49289650 missense probably benign 0.01
R4885:Fgd3 UTSW 13 49263989 missense possibly damaging 0.66
R4962:Fgd3 UTSW 13 49266629 missense probably benign 0.03
R4974:Fgd3 UTSW 13 49278602 missense probably damaging 1.00
R5201:Fgd3 UTSW 13 49296378 missense probably benign 0.00
R5524:Fgd3 UTSW 13 49277577 missense probably damaging 0.97
R5588:Fgd3 UTSW 13 49287310 missense probably damaging 1.00
R5710:Fgd3 UTSW 13 49296729 missense probably benign 0.00
R6048:Fgd3 UTSW 13 49273748 missense probably benign 0.01
R6086:Fgd3 UTSW 13 49287296 missense probably benign 0.12
R7293:Fgd3 UTSW 13 49264658 missense probably benign 0.00
R7311:Fgd3 UTSW 13 49296690 missense possibly damaging 0.94
R7383:Fgd3 UTSW 13 49268309 missense possibly damaging 0.50
R8205:Fgd3 UTSW 13 49296347 missense probably benign 0.11
Z1176:Fgd3 UTSW 13 49281826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTTCCTCTACACGAACG -3'
(R):5'- TCTTGTTGGATCCAAAGCAGAG -3'

Sequencing Primer
(F):5'- TTCCTCTACACGAACGCTAACCTG -3'
(R):5'- TGTTGGATCCAAAGCAGAGAGTCAG -3'
Posted On2016-11-21