Incidental Mutation 'R5753:Spag6l'
ID444916
Institutional Source Beutler Lab
Gene Symbol Spag6l
Ensembl Gene ENSMUSG00000022783
Gene Namesperm associated antigen 6-like
SynonymsPF16, Spag6
MMRRC Submission 043358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R5753 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16753016-16829456 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 16766967 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023468] [ENSMUST00000023468]
Predicted Effect probably null
Transcript: ENSMUST00000023468
SMART Domains Protein: ENSMUSP00000023468
Gene: ENSMUSG00000022783

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
Blast:ARM 72 112 3e-15 BLAST
ARM 114 154 3e-8 SMART
ARM 156 196 4.91e-4 SMART
ARM 198 238 1.03e-6 SMART
ARM 240 280 3.13e0 SMART
ARM 282 322 4.82e1 SMART
ARM 323 365 7.34e-3 SMART
Blast:ARM 367 409 7e-16 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000023468
SMART Domains Protein: ENSMUSP00000023468
Gene: ENSMUSG00000022783

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
Blast:ARM 72 112 3e-15 BLAST
ARM 114 154 3e-8 SMART
ARM 156 196 4.91e-4 SMART
ARM 198 238 1.03e-6 SMART
ARM 240 280 3.13e0 SMART
ARM 282 322 4.82e1 SMART
ARM 323 365 7.34e-3 SMART
Blast:ARM 367 409 7e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154624
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Many homozygotes for a targeted null mutation exhibit reduced growth, hydrocephaly, and lethality by 8 weeks of age. Surviving males have sperm defects and are infertile, while females show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C T 5: 87,972,515 T377I probably damaging Het
Abcb1a A G 5: 8,723,160 D796G probably damaging Het
Actn3 T C 19: 4,864,567 probably null Het
Ada A T 2: 163,735,398 S57T probably benign Het
Adamts6 A G 13: 104,347,350 Y359C probably damaging Het
Adcy1 A T 11: 7,130,300 I348F probably damaging Het
Ankrd11 T C 8: 122,895,304 E603G possibly damaging Het
Bcas3 A G 11: 85,822,084 probably benign Het
Cldn1 C A 16: 26,363,121 V113L probably benign Het
Dock9 T C 14: 121,634,625 T540A probably benign Het
Erp27 A G 6: 136,919,877 F109S probably damaging Het
F13a1 G A 13: 36,898,108 Q541* probably null Het
Fam124a T C 14: 62,606,539 S499P probably benign Het
Fgd3 T A 13: 49,274,940 E486V possibly damaging Het
Flnc T C 6: 29,433,489 S11P probably benign Het
Gm12508 C A 4: 55,254,787 noncoding transcript Het
Grk2 C T 19: 4,290,468 R295H probably damaging Het
Gtf2ird1 A G 5: 134,410,983 M131T probably damaging Het
Hist1h4d G A 13: 23,581,604 M1I probably null Het
Itpripl2 A G 7: 118,491,009 V109A probably damaging Het
Jakmip2 T C 18: 43,559,116 E585G probably damaging Het
Kbtbd3 A T 9: 4,331,404 I593F possibly damaging Het
Lgr4 C T 2: 110,002,512 Q316* probably null Het
Mcf2l T C 8: 12,999,993 F305S probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr1143 A T 2: 87,803,252 M288L probably benign Het
Olfr1264 T C 2: 90,021,503 T188A possibly damaging Het
Olfr1301 T A 2: 111,754,801 I184K possibly damaging Het
Olfr19 A T 16: 16,673,620 Y120* probably null Het
Olfr64 A G 7: 103,893,201 L178P probably damaging Het
Olfr73 G A 2: 88,034,576 L188F probably damaging Het
Olfr735 T A 14: 50,345,588 T285S probably damaging Het
Pcdh9 T A 14: 93,888,161 D191V probably damaging Het
Pde4d T A 13: 109,772,722 probably benign Het
Phkb C T 8: 85,878,230 A88V probably damaging Het
Plec A G 15: 76,173,420 S4128P probably damaging Het
Plekha5 A T 6: 140,537,004 probably null Het
Rgs13 A C 1: 144,140,740 N88K probably benign Het
Rho T A 6: 115,935,487 I104N probably damaging Het
Rnps1 T C 17: 24,418,164 probably benign Het
Slc10a7 G T 8: 78,525,299 probably null Het
Slc39a7 C T 17: 34,030,176 R246K probably damaging Het
Sort1 G C 3: 108,345,774 G510A probably damaging Het
Sync T A 4: 129,293,386 Y70* probably null Het
Tex45 A T 8: 3,484,112 I350L probably benign Het
Timm8a2 T C 14: 122,034,877 V64A probably benign Het
Tnfrsf11b C A 15: 54,254,059 V267L possibly damaging Het
Trim30b A G 7: 104,357,337 V104A possibly damaging Het
Tusc3 T C 8: 39,096,946 S244P probably damaging Het
Usp16 T A 16: 87,482,899 Y746N probably damaging Het
Vax1 G T 19: 59,166,382 H274Q probably benign Het
Vmn2r108 A G 17: 20,462,917 V675A probably damaging Het
Vmn2r12 A T 5: 109,091,804 W298R probably damaging Het
Zfp948 A G 17: 21,586,894 N116S probably damaging Het
Zkscan2 A G 7: 123,480,700 V678A probably benign Het
Other mutations in Spag6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Spag6l APN 16 16780733 missense probably benign 0.20
IGL00928:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL00929:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL01793:Spag6l APN 16 16781857 missense probably damaging 1.00
IGL02380:Spag6l APN 16 16763169 critical splice acceptor site probably null
IGL03271:Spag6l APN 16 16780728 missense probably damaging 1.00
R0284:Spag6l UTSW 16 16780766 missense probably damaging 0.99
R0394:Spag6l UTSW 16 16780629 missense probably benign
R0720:Spag6l UTSW 16 16767096 splice site probably benign
R1205:Spag6l UTSW 16 16787307 missense probably damaging 1.00
R1496:Spag6l UTSW 16 16780614 splice site probably benign
R1707:Spag6l UTSW 16 16780628 missense probably benign 0.00
R1926:Spag6l UTSW 16 16763057 missense probably benign 0.00
R2255:Spag6l UTSW 16 16777339 missense probably damaging 0.96
R2330:Spag6l UTSW 16 16829085 missense probably benign
R3755:Spag6l UTSW 16 16763020 critical splice donor site probably null
R3796:Spag6l UTSW 16 16763052 missense probably damaging 1.00
R4093:Spag6l UTSW 16 16829024 missense probably benign 0.05
R4324:Spag6l UTSW 16 16787235 missense probably benign 0.00
R4725:Spag6l UTSW 16 16792531 missense probably damaging 1.00
R4766:Spag6l UTSW 16 16777390 missense probably benign 0.03
R4877:Spag6l UTSW 16 16781758 missense possibly damaging 0.47
R5958:Spag6l UTSW 16 16763021 critical splice donor site probably null
R6107:Spag6l UTSW 16 16781788 missense possibly damaging 0.56
R6894:Spag6l UTSW 16 16783938 missense probably damaging 1.00
R7329:Spag6l UTSW 16 16767019 missense probably benign
R7634:Spag6l UTSW 16 16777414 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGAGCTTAAAGGACACCGAG -3'
(R):5'- TCCAAATCTAGGAATATAGGCTACG -3'

Sequencing Primer
(F):5'- CTCCAGGGATGCAATTCAGGTTAC -3'
(R):5'- TCCTTCAGAAATGCACCTA -3'
Posted On2016-11-21