Mutagenetix > Incidental Mutations

Incidental Mutation 'R5753:Usp16'

444918

Institutional Source

Beutler Lab

Gene Symbol

Usp16

Ensembl Gene

ENSMUSG00000025616

Gene Name

ubiquitin specific peptidase 16

Synonyms

2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik

MMRRC Submission

043358-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5753 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87454703-87483517 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87482899 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 746 (Y746N)

Ref Sequence

ENSEMBL: ENSMUSP00000026710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026704] [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759] [ENSMUST00000175977] [ENSMUST00000177376]

Predicted Effect

probably benign
Transcript: ENSMUST00000026704

SMART Domains

Protein: ENSMUSP00000026704
Gene: ENSMUSG00000025613

Domain	Start	End	E-Value	Type
Pfam:Cpn60_TCP1	39	529	6.7e-156	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000026710
AA Change: Y746N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: Y746N

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	2.5e-23	PFAM
coiled coil region	149	182	N/A	INTRINSIC
Pfam:UCH	194	821	2e-54	PFAM
Pfam:UCH_1	195	800	3.8e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119504

SMART Domains

Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	6.9e-24	PFAM
coiled coil region	149	181	N/A	INTRINSIC
Pfam:UCH	193	732	1.2e-36	PFAM
Pfam:UCH_1	194	737	2.5e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135399

Predicted Effect

probably benign
Transcript: ENSMUST00000144759

SMART Domains

Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	2e-24	PFAM
coiled coil region	149	181	N/A	INTRINSIC
Pfam:UCH	193	330	2.4e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149656

Predicted Effect

probably benign
Transcript: ENSMUST00000175750

SMART Domains

Protein: ENSMUSP00000134920
Gene: ENSMUSG00000025613

Domain	Start	End	E-Value	Type
Pfam:Cpn60_TCP1	1	238	1.2e-69	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175977

SMART Domains

Protein: ENSMUSP00000135651
Gene: ENSMUSG00000025613

Domain	Start	End	E-Value	Type
Pfam:Cpn60_TCP1	39	132	4.5e-32	PFAM
Pfam:Cpn60_TCP1	120	470	1.9e-94	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176241

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176589

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177275

Predicted Effect

probably benign
Transcript: ENSMUST00000177376

SMART Domains

Protein: ENSMUSP00000135498
Gene: ENSMUSG00000025613

Domain	Start	End	E-Value	Type
PDB:4B2T\|Q	1	51	1e-29	PDB
SCOP:d1oela1	26	51	8e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177485

Meta Mutation Damage Score

0.9018

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	C	T	5: 87,972,515	T377I	probably damaging	Het
Abcb1a	A	G	5: 8,723,160	D796G	probably damaging	Het
Actn3	T	C	19: 4,864,567		probably null	Het
Ada	A	T	2: 163,735,398	S57T	probably benign	Het
Adamts6	A	G	13: 104,347,350	Y359C	probably damaging	Het
Adcy1	A	T	11: 7,130,300	I348F	probably damaging	Het
Ankrd11	T	C	8: 122,895,304	E603G	possibly damaging	Het
Bcas3	A	G	11: 85,822,084		probably benign	Het
Cldn1	C	A	16: 26,363,121	V113L	probably benign	Het
Dock9	T	C	14: 121,634,625	T540A	probably benign	Het
Erp27	A	G	6: 136,919,877	F109S	probably damaging	Het
F13a1	G	A	13: 36,898,108	Q541*	probably null	Het
Fam124a	T	C	14: 62,606,539	S499P	probably benign	Het
Fgd3	T	A	13: 49,274,940	E486V	possibly damaging	Het
Flnc	T	C	6: 29,433,489	S11P	probably benign	Het
Gm12508	C	A	4: 55,254,787		noncoding transcript	Het
Grk2	C	T	19: 4,290,468	R295H	probably damaging	Het
Gtf2ird1	A	G	5: 134,410,983	M131T	probably damaging	Het
Hist1h4d	G	A	13: 23,581,604	M1I	probably null	Het
Itpripl2	A	G	7: 118,491,009	V109A	probably damaging	Het
Jakmip2	T	C	18: 43,559,116	E585G	probably damaging	Het
Kbtbd3	A	T	9: 4,331,404	I593F	possibly damaging	Het
Lgr4	C	T	2: 110,002,512	Q316*	probably null	Het
Mcf2l	T	C	8: 12,999,993	F305S	probably damaging	Het
Nos1ap	T	A	1: 170,349,399	K145M	probably damaging	Het
Olfr1143	A	T	2: 87,803,252	M288L	probably benign	Het
Olfr1264	T	C	2: 90,021,503	T188A	possibly damaging	Het
Olfr1301	T	A	2: 111,754,801	I184K	possibly damaging	Het
Olfr19	A	T	16: 16,673,620	Y120*	probably null	Het
Olfr64	A	G	7: 103,893,201	L178P	probably damaging	Het
Olfr73	G	A	2: 88,034,576	L188F	probably damaging	Het
Olfr735	T	A	14: 50,345,588	T285S	probably damaging	Het
Pcdh9	T	A	14: 93,888,161	D191V	probably damaging	Het
Pde4d	T	A	13: 109,772,722		probably benign	Het
Phkb	C	T	8: 85,878,230	A88V	probably damaging	Het
Plec	A	G	15: 76,173,420	S4128P	probably damaging	Het
Plekha5	A	T	6: 140,537,004		probably null	Het
Rgs13	A	C	1: 144,140,740	N88K	probably benign	Het
Rho	T	A	6: 115,935,487	I104N	probably damaging	Het
Rnps1	T	C	17: 24,418,164		probably benign	Het
Slc10a7	G	T	8: 78,525,299		probably null	Het
Slc39a7	C	T	17: 34,030,176	R246K	probably damaging	Het
Sort1	G	C	3: 108,345,774	G510A	probably damaging	Het
Spag6l	A	G	16: 16,766,967		probably null	Het
Sync	T	A	4: 129,293,386	Y70*	probably null	Het
Tex45	A	T	8: 3,484,112	I350L	probably benign	Het
Timm8a2	T	C	14: 122,034,877	V64A	probably benign	Het
Tnfrsf11b	C	A	15: 54,254,059	V267L	possibly damaging	Het
Trim30b	A	G	7: 104,357,337	V104A	possibly damaging	Het
Tusc3	T	C	8: 39,096,946	S244P	probably damaging	Het
Vax1	G	T	19: 59,166,382	H274Q	probably benign	Het
Vmn2r108	A	G	17: 20,462,917	V675A	probably damaging	Het
Vmn2r12	A	T	5: 109,091,804	W298R	probably damaging	Het
Zfp948	A	G	17: 21,586,894	N116S	probably damaging	Het
Zkscan2	A	G	7: 123,480,700	V678A	probably benign	Het

Other mutations in Usp16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Usp16	APN	16	87466276	missense	possibly damaging	0.95
IGL01589:Usp16	APN	16	87479183	missense	probably benign	0.00
IGL02570:Usp16	APN	16	87480893	missense	probably damaging	1.00
IGL02736:Usp16	APN	16	87464835	missense	possibly damaging	0.75
IGL02973:Usp16	APN	16	87479739	missense	probably damaging	1.00
IGL03066:Usp16	APN	16	87471833	missense	probably damaging	1.00
PIT1430001:Usp16	UTSW	16	87473132	missense	probably damaging	0.99
R0395:Usp16	UTSW	16	87475446	missense	probably damaging	1.00
R0619:Usp16	UTSW	16	87472164	missense	probably benign	0.02
R1146:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
R1146:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
R1549:Usp16	UTSW	16	87464834	missense	probably damaging	1.00
R1557:Usp16	UTSW	16	87462142	critical splice donor site	probably null
R1776:Usp16	UTSW	16	87479316	missense	probably damaging	0.97
R1818:Usp16	UTSW	16	87479132	nonsense	probably null
R1835:Usp16	UTSW	16	87480907	missense	probably damaging	1.00
R2022:Usp16	UTSW	16	87473126	missense	probably damaging	1.00
R2146:Usp16	UTSW	16	87473187	critical splice donor site	probably null
R2432:Usp16	UTSW	16	87466358	critical splice donor site	probably null
R3110:Usp16	UTSW	16	87471848	splice site	probably null
R3112:Usp16	UTSW	16	87471848	splice site	probably null
R3771:Usp16	UTSW	16	87458683	start codon destroyed	probably null	1.00
R4353:Usp16	UTSW	16	87470354	missense	probably damaging	1.00
R4959:Usp16	UTSW	16	87480914	missense	probably damaging	0.99
R4973:Usp16	UTSW	16	87480914	missense	probably damaging	0.99
R5276:Usp16	UTSW	16	87470451	critical splice donor site	probably null
R6230:Usp16	UTSW	16	87464798	missense	possibly damaging	0.48
R6267:Usp16	UTSW	16	87483191	missense	probably benign	0.00
R6473:Usp16	UTSW	16	87483135	missense	probably benign	0.00
R6736:Usp16	UTSW	16	87470397	missense	probably damaging	1.00
R7006:Usp16	UTSW	16	87471836	missense	probably damaging	1.00
R7012:Usp16	UTSW	16	87458744	critical splice donor site	probably null
R7040:Usp16	UTSW	16	87480929	missense	probably damaging	1.00
R7136:Usp16	UTSW	16	87483171	missense	probably benign
R7295:Usp16	UTSW	16	87472089	missense	probably benign	0.44
R7434:Usp16	UTSW	16	87479319	nonsense	probably null
R7497:Usp16	UTSW	16	87466286	nonsense	probably null
R7571:Usp16	UTSW	16	87464835	missense	possibly damaging	0.75
R7576:Usp16	UTSW	16	87479300	missense	probably benign	0.34
R7624:Usp16	UTSW	16	87476805	missense	probably benign	0.23
X0061:Usp16	UTSW	16	87479457	missense	probably benign	0.01
X0064:Usp16	UTSW	16	87471725	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GAATTTTCTTGAGGCCTTTAACTGG -3'
(R):5'- GTGAAACCACTGCCCTTTGG -3'

Sequencing Primer
(F):5'- GGTTCATGACCTAGTTTTTGCAC -3'
(R):5'- GATTCCATTTCACAATCTGTCAGG -3'

Posted On

2016-11-21