Incidental Mutation 'R0027:Lamc1'
ID 44492
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Name laminin, gamma 1
Synonyms laminin B2, Lamb2
MMRRC Submission 038322-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0027 (G1) of strain 730
Quality Score 225
Status Validated (trace)
Chromosome 1
Chromosomal Location 153218922-153332786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 153262583 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 175 (Y175C)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027752
AA Change: Y175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: Y175C

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Meta Mutation Damage Score 0.9422 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A T 15: 11,285,873 I723F probably damaging Het
Anapc1 G T 2: 128,641,511 D1221E possibly damaging Het
Arhgef28 T A 13: 97,945,696 E1201V possibly damaging Het
Capn12 T A 7: 28,881,960 H79Q probably benign Het
Caprin1 A T 2: 103,775,580 probably benign Het
Carmil3 T A 14: 55,494,403 F196Y probably damaging Het
Casp8ap2 A G 4: 32,643,810 H961R probably benign Het
Cdkl3 C T 11: 52,032,349 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Col13a1 A G 10: 61,850,161 L684P unknown Het
D10Wsu102e G A 10: 83,364,529 probably benign Het
D430041D05Rik A T 2: 104,255,044 F1053L probably benign Het
Dab1 T C 4: 104,704,199 probably benign Het
Dmxl1 A T 18: 49,957,295 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
E130309D02Rik G A 5: 143,308,062 T220I probably damaging Het
Eml1 T C 12: 108,536,298 C708R possibly damaging Het
Fam131b T A 6: 42,318,248 M304L probably benign Het
Foxk1 A T 5: 142,450,340 I321F probably damaging Het
Gm10306 C T 4: 94,556,790 probably benign Het
Gm10985 TA TANA 3: 53,845,256 probably null Het
Gse1 T C 8: 120,566,546 probably benign Het
Hcn3 A G 3: 89,159,825 S79P probably damaging Het
Hspa4 T A 11: 53,283,585 M203L probably benign Het
Kctd7 G A 5: 130,152,573 R279H probably damaging Het
Kif11 C T 19: 37,406,983 probably benign Het
Klf13 T C 7: 63,891,761 N206S probably benign Het
Kpna7 A T 5: 144,989,697 Y482N probably damaging Het
Lrpprc G A 17: 84,767,007 R491* probably null Het
Madd T A 2: 91,152,549 I1350F probably damaging Het
Mbtd1 T C 11: 93,924,549 V321A possibly damaging Het
Mon2 G A 10: 123,036,048 S357L possibly damaging Het
Ndst3 A G 3: 123,671,513 V270A probably damaging Het
Nlrp2 T C 7: 5,322,448 T742A probably damaging Het
Olfr214 T C 6: 116,556,949 S175P probably damaging Het
Papola A C 12: 105,833,136 S675R probably benign Het
Pcdh9 T A 14: 93,888,645 I30F probably null Het
Prl6a1 T A 13: 27,318,028 L126Q probably damaging Het
Prr29 A G 11: 106,376,276 E89G possibly damaging Het
Psmd1 T C 1: 86,094,265 probably benign Het
Rad9b A G 5: 122,351,723 probably benign Het
Rest T C 5: 77,282,551 V939A probably benign Het
Rnf135 T A 11: 80,193,942 S180R probably benign Het
Sarm1 C A 11: 78,488,091 R376L probably damaging Het
Scap C A 9: 110,379,730 P613Q probably benign Het
Scube3 C T 17: 28,164,357 R374* probably null Het
Setx T G 2: 29,139,221 V167G probably damaging Het
Snrnp40 T A 4: 130,368,273 H151Q probably damaging Het
Sox21 G T 14: 118,235,617 H7N probably benign Het
Stard9 A T 2: 120,703,501 Q3413L probably benign Het
Sycp1 A G 3: 102,895,910 V528A probably benign Het
Tcl1b3 A T 12: 105,191,239 S47C probably damaging Het
Treml4 T C 17: 48,264,934 S122P possibly damaging Het
Trip11 C T 12: 101,885,169 A879T probably benign Het
Ubr4 C A 4: 139,400,393 N567K probably damaging Het
Zan T C 5: 137,406,519 probably benign Het
Zfp804a G A 2: 82,257,200 D458N probably damaging Het
Zic2 T C 14: 122,476,343 M223T possibly damaging Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153240495 missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153251134 missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153221573 missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153247082 missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153240433 missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153247042 missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153249853 missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153250661 missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153247055 missense probably benign 0.00
IGL03069:Lamc1 APN 1 153239381 missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153332274 missense probably benign 0.00
IGL03166:Lamc1 APN 1 153332301 missense probably benign 0.01
IGL03285:Lamc1 APN 1 153227685 missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153262646 missense probably damaging 1.00
pride UTSW 1 153247284 missense probably benign 0.01
Stratum UTSW 1 153251124 nonsense probably null
tier UTSW 1 153250522 missense probably damaging 1.00
PIT4280001:Lamc1 UTSW 1 153243471 missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153262439 missense probably damaging 0.99
R0060:Lamc1 UTSW 1 153241868 unclassified probably benign
R0078:Lamc1 UTSW 1 153229190 missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153262607 missense probably benign 0.00
R0282:Lamc1 UTSW 1 153255312 missense probably benign
R0374:Lamc1 UTSW 1 153251065 splice site probably benign
R0494:Lamc1 UTSW 1 153246936 critical splice donor site probably null
R0502:Lamc1 UTSW 1 153246932 splice site probably benign
R0755:Lamc1 UTSW 1 153247450 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0792:Lamc1 UTSW 1 153234580 missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153234595 missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153234612 missense probably benign 0.01
R0892:Lamc1 UTSW 1 153332254 missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153332274 missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153221700 missense probably benign 0.03
R0961:Lamc1 UTSW 1 153221646 frame shift probably null
R0963:Lamc1 UTSW 1 153243386 missense probably benign
R1127:Lamc1 UTSW 1 153250459 missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153247231 splice site probably benign
R1175:Lamc1 UTSW 1 153247231 splice site probably benign
R1449:Lamc1 UTSW 1 153250495 missense probably benign
R1481:Lamc1 UTSW 1 153221634 missense probably damaging 1.00
R1565:Lamc1 UTSW 1 153242743 missense probably benign 0.34
R1583:Lamc1 UTSW 1 153243478 critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153258072 splice site probably benign
R1652:Lamc1 UTSW 1 153249646 missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153247249 missense probably benign 0.04
R1854:Lamc1 UTSW 1 153249872 missense probably damaging 0.99
R2018:Lamc1 UTSW 1 153242632 missense probably benign 0.07
R2170:Lamc1 UTSW 1 153249142 missense probably benign 0.07
R2410:Lamc1 UTSW 1 153247395 missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153226415 missense probably benign 0.04
R3615:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153251150 missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153255205 missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153262708 splice site probably null
R4285:Lamc1 UTSW 1 153234552 missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153221528 missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153247269 missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153242696 missense probably benign 0.04
R4649:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153228777 missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153231740 missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153229100 missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153227696 missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153233564 missense probably damaging 0.99
R5597:Lamc1 UTSW 1 153251970 missense probably damaging 1.00
R5754:Lamc1 UTSW 1 153247284 missense probably benign 0.01
R6233:Lamc1 UTSW 1 153223666 missense probably benign
R6431:Lamc1 UTSW 1 153221671 missense probably benign 0.21
R6636:Lamc1 UTSW 1 153241975 missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153262492 missense probably damaging 1.00
R7161:Lamc1 UTSW 1 153226454 missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153234650 missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153249076 missense probably damaging 1.00
R7474:Lamc1 UTSW 1 153332265 missense possibly damaging 0.81
R7570:Lamc1 UTSW 1 153243275 missense possibly damaging 0.64
R7583:Lamc1 UTSW 1 153243232 missense possibly damaging 0.71
R7597:Lamc1 UTSW 1 153240454 missense possibly damaging 0.94
R7635:Lamc1 UTSW 1 153249060 missense probably damaging 1.00
R7976:Lamc1 UTSW 1 153247268 missense probably damaging 1.00
R8012:Lamc1 UTSW 1 153221612 missense probably benign 0.04
R8207:Lamc1 UTSW 1 153250522 missense probably damaging 1.00
R8219:Lamc1 UTSW 1 153247327 missense probably damaging 1.00
R8227:Lamc1 UTSW 1 153223754 missense probably benign 0.04
R8315:Lamc1 UTSW 1 153243421 missense probably benign 0.00
R8417:Lamc1 UTSW 1 153230769 missense probably damaging 1.00
R8685:Lamc1 UTSW 1 153233542 missense probably benign 0.31
R8827:Lamc1 UTSW 1 153221678 missense probably damaging 1.00
R8995:Lamc1 UTSW 1 153332247 missense probably benign 0.00
R9061:Lamc1 UTSW 1 153251124 nonsense probably null
R9141:Lamc1 UTSW 1 153247450 missense probably benign 0.01
R9187:Lamc1 UTSW 1 153221688 nonsense probably null
R9206:Lamc1 UTSW 1 153250451 missense probably damaging 1.00
R9222:Lamc1 UTSW 1 153243341 missense probably damaging 0.96
R9297:Lamc1 UTSW 1 153252000 missense probably damaging 1.00
R9318:Lamc1 UTSW 1 153252000 missense probably damaging 1.00
R9377:Lamc1 UTSW 1 153239263 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTCCAGGGTTGAAAAGGCCAC -3'
(R):5'- TGGGCAATTTCCAGGCTTAGACG -3'

Sequencing Primer
(F):5'- TTGAAAAGGCCACGTTGC -3'
(R):5'- CAGGCTTAGACGAGCCTAC -3'
Posted On 2013-06-11